Incidental Mutation 'R7633:Prdm11'
ID589740
Institutional Source Beutler Lab
Gene Symbol Prdm11
Ensembl Gene ENSMUSG00000075028
Gene NamePR domain containing 11
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92965151-93046167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92980654 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 200 (A200V)
Ref Sequence ENSEMBL: ENSMUSP00000106905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111272] [ENSMUST00000111274] [ENSMUST00000178666]
Predicted Effect probably benign
Transcript: ENSMUST00000111272
SMART Domains Protein: ENSMUSP00000106903
Gene: ENSMUSG00000075028

DomainStartEndE-ValueType
SANT 147 217 3.94e-3 SMART
low complexity region 291 312 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111274
AA Change: A200V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106905
Gene: ENSMUSG00000075028
AA Change: A200V

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178666
AA Change: A200V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136795
Gene: ENSMUSG00000075028
AA Change: A200V

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Synpo G A 18: 60,603,428 T482I probably damaging Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Prdm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Prdm11 APN 2 93012757 missense probably damaging 1.00
IGL02108:Prdm11 APN 2 92975703 missense probably damaging 1.00
IGL02166:Prdm11 APN 2 93012863 missense probably damaging 1.00
IGL02369:Prdm11 APN 2 92975519 missense probably benign 0.00
IGL02388:Prdm11 APN 2 92975612 missense possibly damaging 0.90
IGL02606:Prdm11 APN 2 92975603 missense probably benign 0.02
IGL02967:Prdm11 APN 2 93012889 missense probably damaging 1.00
IGL03085:Prdm11 APN 2 92974959 missense possibly damaging 0.86
IGL03125:Prdm11 APN 2 92980622 missense probably benign 0.22
E0370:Prdm11 UTSW 2 92980579 missense probably damaging 1.00
R0607:Prdm11 UTSW 2 93013785 missense possibly damaging 0.85
R0964:Prdm11 UTSW 2 92989222 intron probably benign
R4011:Prdm11 UTSW 2 93012830 missense probably damaging 1.00
R4298:Prdm11 UTSW 2 92993383 missense probably benign 0.44
R4951:Prdm11 UTSW 2 92980609 missense probably damaging 1.00
R5150:Prdm11 UTSW 2 92975472 missense probably damaging 1.00
R5320:Prdm11 UTSW 2 93012881 missense probably benign 0.00
R5432:Prdm11 UTSW 2 92975813 missense probably benign 0.00
R6442:Prdm11 UTSW 2 92975645 missense probably benign 0.34
R6754:Prdm11 UTSW 2 93013792 missense probably damaging 1.00
R7403:Prdm11 UTSW 2 92986691 missense probably benign
R7480:Prdm11 UTSW 2 92975324 missense probably benign 0.05
R7497:Prdm11 UTSW 2 93012707 missense possibly damaging 0.93
R7873:Prdm11 UTSW 2 92989283 missense probably benign 0.01
R7956:Prdm11 UTSW 2 92989283 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTTAGCATTATGGGCATGTCC -3'
(R):5'- TAGGAGGACCAGCTCTATAGTTG -3'

Sequencing Primer
(F):5'- ATGTCCCTGGCCCTGAG -3'
(R):5'- CCAGCTCTATAGTTGGCTGTC -3'
Posted On2019-10-24