Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Vav1'

591900

Institutional Source

Beutler Lab

Gene Symbol

Vav1

Ensembl Gene

ENSMUSG00000034116

Gene Name

vav 1 oncogene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.446) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57279100-57328031 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57297086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 163 (V163M)

Ref Sequence

ENSEMBL: ENSMUSP00000005889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]

AlphaFold

P27870

PDB Structure

NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005889
AA Change: V163M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: V163M

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	669	751	8.88e-25	SMART
SH3	785	841	1.44e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112870
AA Change: V163M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: V163M

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	633	712	3.93e-2	SMART
SH3	746	802	1.44e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169220
AA Change: V139M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: V139M

Domain	Start	End	E-Value	Type
Pfam:CAMSAP_CH	27	79	6.2e-11	PFAM
RhoGEF	174	348	7.89e-62	SMART
PH	379	482	8.45e-12	SMART
C1	492	540	3.67e-9	SMART
SH3	571	635	1.65e-8	SMART
SH2	645	727	8.88e-25	SMART
SH3	761	817	1.44e-22	SMART

Meta Mutation Damage Score

0.1772

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Vav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Vav1	APN	17	57299176	missense	probably benign	0.21
IGL01613:Vav1	APN	17	57307067	missense	possibly damaging	0.93
IGL02032:Vav1	APN	17	57297090	missense	possibly damaging	0.91
IGL02213:Vav1	APN	17	57305351	missense	possibly damaging	0.84
IGL03009:Vav1	APN	17	57296582	missense	probably benign	0.38
Belated	UTSW	17	57301214	missense	probably benign	0.06
Delayed	UTSW	17	57296552	missense	probably damaging	1.00
Endlich	UTSW	17	57297086	missense	probably damaging	1.00
finally	UTSW	17	57311860	nonsense	probably null
Last	UTSW	17	57296039	missense	probably damaging	0.99
Late	UTSW	17	57301870	missense	possibly damaging	0.91
Plain_sight	UTSW	17	57297122	missense	probably damaging	1.00
tardive	UTSW	17	57303079	nonsense	probably null
R0116:Vav1	UTSW	17	57296039	missense	probably damaging	0.99
R0125:Vav1	UTSW	17	57299847	missense	probably damaging	1.00
R0268:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0344:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0579:Vav1	UTSW	17	57279271	missense	probably benign	0.01
R0634:Vav1	UTSW	17	57303862	missense	probably benign	0.00
R1313:Vav1	UTSW	17	57309498	splice site	probably benign
R1345:Vav1	UTSW	17	57301214	missense	probably benign	0.06
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1579:Vav1	UTSW	17	57297252	missense	probably benign	0.05
R1872:Vav1	UTSW	17	57324750	missense	probably damaging	1.00
R1971:Vav1	UTSW	17	57327697	missense	probably damaging	1.00
R2197:Vav1	UTSW	17	57303140	missense	probably benign	0.37
R2903:Vav1	UTSW	17	57306187	missense	probably benign	0.05
R4623:Vav1	UTSW	17	57299839	splice site	probably null
R4753:Vav1	UTSW	17	57306140	missense	probably damaging	0.98
R4779:Vav1	UTSW	17	57296552	missense	probably damaging	1.00
R5232:Vav1	UTSW	17	57303846	missense	possibly damaging	0.81
R5240:Vav1	UTSW	17	57297122	missense	probably damaging	1.00
R5503:Vav1	UTSW	17	57303079	nonsense	probably null
R5592:Vav1	UTSW	17	57304835	missense	probably benign	0.00
R5782:Vav1	UTSW	17	57296001	missense	probably damaging	1.00
R5945:Vav1	UTSW	17	57301870	missense	possibly damaging	0.91
R6113:Vav1	UTSW	17	57301884	missense	probably benign	0.00
R6514:Vav1	UTSW	17	57327660	missense	probably damaging	1.00
R6575:Vav1	UTSW	17	57305280	missense	probably damaging	0.97
R6932:Vav1	UTSW	17	57302330	missense	possibly damaging	0.92
R7024:Vav1	UTSW	17	57279268	missense	probably damaging	1.00
R7063:Vav1	UTSW	17	57311860	nonsense	probably null
R7322:Vav1	UTSW	17	57302266	missense	probably benign
R7335:Vav1	UTSW	17	57296720	missense	probably benign
R7474:Vav1	UTSW	17	57299102	missense	probably benign	0.07
R8964:Vav1	UTSW	17	57299122	missense	probably benign
R8978:Vav1	UTSW	17	57296710	missense	probably benign	0.04
R8978:Vav1	UTSW	17	57324650	missense	probably benign
R9165:Vav1	UTSW	17	57311895	missense	probably damaging	1.00
R9453:Vav1	UTSW	17	57306191	missense	probably benign
R9728:Vav1	UTSW	17	57305459	missense	probably benign	0.00
Z1176:Vav1	UTSW	17	57303853	missense	probably damaging	1.00
Z1177:Vav1	UTSW	17	57303040	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TCTGAAGGGACACAGATCTGTC -3'
(R):5'- AGCAGCGCTTATCATACTCTG -3'

Sequencing Primer
(F):5'- AGATCTGTCCCAGAGTCTGACAG -3'
(R):5'- ATCATACTCTGTCATCTTGGGCTGTG -3'

Posted On

2019-11-12