Incidental Mutation 'R7717:Zbtb17'
ID 594968
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Name zinc finger and BTB domain containing 17
Synonyms mZ13, Zfp100, Miz1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141444654-141467930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141466083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 593 (S593P)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold Q60821
Predicted Effect probably damaging
Transcript: ENSMUST00000006377
AA Change: S593P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: S593P

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141466367 nonsense probably null
IGL01449:Zbtb17 APN 4 141463305 missense probably benign
IGL01835:Zbtb17 APN 4 141465438 critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141464953 missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141464982 missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141461829 missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141461913 missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141466885 missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141465088 missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141466933 missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141466758 missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141463380 missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141466096 splice site probably null
R0736:Zbtb17 UTSW 4 141461786 missense probably damaging 1.00
R1924:Zbtb17 UTSW 4 141464603 missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141465548 missense possibly damaging 0.83
R2164:Zbtb17 UTSW 4 141464246 missense probably benign
R2517:Zbtb17 UTSW 4 141464585 missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141464988 missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141464575 missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141466498 missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141466549 missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141465631 missense probably benign 0.22
R5363:Zbtb17 UTSW 4 141466761 missense probably benign 0.02
R5987:Zbtb17 UTSW 4 141464817 missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6320:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6365:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141464950 missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141461799 missense probably damaging 1.00
R7999:Zbtb17 UTSW 4 141461823 missense probably damaging 1.00
R8542:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8544:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8545:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8836:Zbtb17 UTSW 4 141461922 missense possibly damaging 0.68
R9072:Zbtb17 UTSW 4 141466365 missense possibly damaging 0.50
R9073:Zbtb17 UTSW 4 141466365 missense possibly damaging 0.50
R9389:Zbtb17 UTSW 4 141465820 missense possibly damaging 0.89
Z1176:Zbtb17 UTSW 4 141463679 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAAATCTCAGGCTGTGTCC -3'
(R):5'- AGTTCTCTAAGGCAGCCACC -3'

Sequencing Primer
(F):5'- AAATCTCAGGCTGTGTCCCAGAG -3'
(R):5'- TTCTCTAAGGCAGCCACCAGAAG -3'
Posted On 2019-11-12