Incidental Mutation 'R7717:Secisbp2'
ID 594991
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene Name SECIS binding protein 2
Synonyms SBP2, 2210413N07Rik, 2810012K13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 51651697-51684044 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51673098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000045740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117]
AlphaFold Q3U1C4
Predicted Effect probably benign
Transcript: ENSMUST00000040117
AA Change: V414A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1220:Secisbp2 UTSW 13 51656905 missense probably damaging 1.00
R1278:Secisbp2 UTSW 13 51654510 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5183:Secisbp2 UTSW 13 51665424 missense probably benign 0.14
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R5696:Secisbp2 UTSW 13 51679821 missense probably damaging 1.00
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R6888:Secisbp2 UTSW 13 51679941 missense probably benign 0.16
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
R7261:Secisbp2 UTSW 13 51682462 missense probably damaging 1.00
R7986:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R8021:Secisbp2 UTSW 13 51665628 makesense probably null
R8496:Secisbp2 UTSW 13 51665347 missense probably damaging 1.00
R8755:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8757:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8758:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8759:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8833:Secisbp2 UTSW 13 51665316 missense probably benign 0.01
R8878:Secisbp2 UTSW 13 51683368 missense probably benign 0.13
R9153:Secisbp2 UTSW 13 51679819 missense possibly damaging 0.92
R9295:Secisbp2 UTSW 13 51654447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGTGATAACTCCAGCTG -3'
(R):5'- CTTAATAGGGACTCAGCTGCTCTC -3'

Sequencing Primer
(F):5'- CTGTGATAACTCCAGCTGTGTCAAG -3'
(R):5'- GCTCTCCCTAGATGAAATCCCTAGG -3'
Posted On 2019-11-12