Incidental Mutation 'R7824:Ubr5'
ID602096
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37991322 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1992 (H1992Q)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: H1986Q

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: H1992Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7710:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7803:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7841:Ubr5 UTSW 15 37980906 missense
R7869:Ubr5 UTSW 15 37979832 missense probably null
R7896:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R7924:Ubr5 UTSW 15 37980906 missense
R7952:Ubr5 UTSW 15 37979832 missense probably null
R7979:Ubr5 UTSW 15 38041573 missense probably benign 0.31
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38040755 missense
Predicted Primers PCR Primer
(F):5'- ATCAGCTGCCCTTACAAGACTC -3'
(R):5'- GCTTGCCTAACCACCTGAGTTC -3'

Sequencing Primer
(F):5'- GGAAAATTCAGAGCATTAACTCAGTC -3'
(R):5'- TTCCATGGACAAGCTGTGAC -3'
Posted On2019-12-03