Mutagenetix > Incidental Mutations

Incidental Mutation 'R7824:Ubr5'

602096

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37991322 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1992 (H1992Q)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

Predicted Effect

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: H1986Q

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226414
AA Change: H1992Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.0727

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apol7a	T	C	15: 77,389,075	R396G	probably damaging	Het
Arhgap40	A	T	2: 158,534,746	R267S	probably damaging	Het
Asb5	A	C	8: 54,584,792	H173P		Het
Atp6v0a2	A	G	5: 124,641,505	E186G	probably damaging	Het
Bbs2	A	T	8: 94,089,760		probably null	Het
Bub1b	T	G	2: 118,626,967		probably null	Het
Capn7	A	G	14: 31,352,410	T257A	probably benign	Het
Chrna6	T	C	8: 27,407,364	I162V	probably damaging	Het
Cldn6	T	A	17: 23,681,607	C182S	probably damaging	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Cysltr2	A	G	14: 73,029,763	I169T	probably benign	Het
Ddx11	T	C	17: 66,130,548		probably null	Het
Efhc1	A	T	1: 20,979,461	Y515F	probably damaging	Het
Farsb	T	C	1: 78,469,299	N148D	probably benign	Het
Fmnl2	C	T	2: 53,073,680	L275F	unknown	Het
Gfpt2	T	G	11: 49,824,441	I421R	probably damaging	Het
Gm8297	A	G	14: 4,986,951	N193S	possibly damaging	Het
Hic1	C	T	11: 75,166,216	V616M	possibly damaging	Het
Ica1l	T	G	1: 60,007,870	M241L	probably benign	Het
Ighg3	A	T	12: 113,359,806	D283E		Het
Ing1	A	G	8: 11,561,814	E178G	probably benign	Het
Ism2	A	C	12: 87,279,860	V435G	probably damaging	Het
Klhdc2	A	G	12: 69,307,228	H271R	probably damaging	Het
Lama1	T	A	17: 67,804,473	S2240T		Het
Lrp2	T	A	2: 69,501,539	E1624V	possibly damaging	Het
Map3k21	C	G	8: 125,910,963	P96R	probably benign	Het
Mfge8	G	T	7: 79,145,387		probably null	Het
Micalcl	T	A	7: 112,407,637	Y588N	probably damaging	Het
Mrps15	A	T	4: 126,051,377	N119I	probably damaging	Het
Mybpc2	G	A	7: 44,504,860		probably null	Het
Myo9a	T	A	9: 59,860,109	H865Q	probably damaging	Het
Odf4	A	T	11: 68,922,072	S253R	probably benign	Het
Olfr787	A	G	10: 129,462,796	N40S	probably damaging	Het
Ovch2	A	G	7: 107,789,088		probably null	Het
Pax8	A	G	2: 24,435,901	S324P	possibly damaging	Het
Plau	A	G	14: 20,842,325	S393G	probably benign	Het
Primpol	G	T	8: 46,586,424	P387Q	probably damaging	Het
Prph2	T	C	17: 46,910,806	L37S	possibly damaging	Het
Rapgefl1	A	G	11: 98,851,154	N648S	probably damaging	Het
Rin2	T	A	2: 145,861,117	S533T	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Setd6	A	T	8: 95,716,238	H101L	probably benign	Het
Sez6	T	C	11: 77,974,549	S671P	probably damaging	Het
Slc22a3	G	T	17: 12,464,463	A171E	probably damaging	Het
Son	T	C	16: 91,656,528	L721S	probably damaging	Het
Spata31d1b	A	T	13: 59,717,233	R732W	possibly damaging	Het
Speg	T	A	1: 75,384,017		probably null	Het
Srd5a3	T	A	5: 76,154,771	F328I	probably damaging	Het
Tbc1d2	C	T	4: 46,637,746		probably null	Het
Tfap2b	G	A	1: 19,234,307	G447D	probably damaging	Het
Thoc3	A	C	13: 54,463,778	F232C	probably damaging	Het
Togaram2	T	A	17: 71,704,751	M476K	probably benign	Het
Tpgs2	G	T	18: 25,129,865	F232L	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Tube1	A	G	10: 39,142,298	I124V	probably benign	Het
Utrn	G	A	10: 12,486,610	R2660C	probably damaging	Het
Vcan	T	C	13: 89,688,654	T2924A	probably damaging	Het
Vmn2r120	T	C	17: 57,525,942	Y79C	probably damaging	Het
Vwa8	T	C	14: 79,038,147	V790A	probably benign	Het
Vwf	A	G	6: 125,658,815	K270E		Het
Zfp874b	A	G	13: 67,473,974	F402L	probably benign	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense	probably damaging	0.98
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- ATCAGCTGCCCTTACAAGACTC -3'
(R):5'- GCTTGCCTAACCACCTGAGTTC -3'

Sequencing Primer
(F):5'- GGAAAATTCAGAGCATTAACTCAGTC -3'
(R):5'- TTCCATGGACAAGCTGTGAC -3'

Posted On

2019-12-03