Incidental Mutation 'R8021:Slit2'
ID617354
Institutional Source Beutler Lab
Gene Symbol Slit2
Ensembl Gene ENSMUSG00000031558
Gene Nameslit guidance ligand 2
SynonymsDrad-1, Slil3, E130320P19Rik, E030015M03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178804.3; MGI: 1315205

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location47983138-48307733 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 48302492 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1371 (C1371*)
Ref Sequence ENSEMBL: ENSMUSP00000134263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033967] [ENSMUST00000170109] [ENSMUST00000173107] [ENSMUST00000173686] [ENSMUST00000174313] [ENSMUST00000174421]
Predicted Effect probably benign
Transcript: ENSMUST00000033967
SMART Domains Protein: ENSMUSP00000033967
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170109
AA Change: C1362*
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558
AA Change: C1362*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173107
AA Change: C1350*
SMART Domains Protein: ENSMUSP00000133840
Gene: ENSMUSG00000031558
AA Change: C1350*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 505 537 1.45e-6 SMART
LRR_TYP 557 580 1.38e-3 SMART
LRR 605 628 9.96e-1 SMART
LRR_TYP 629 652 2.71e-2 SMART
LRRCT 664 713 3.56e-7 SMART
LRRNT 726 758 3.69e-8 SMART
LRR 776 799 7.36e0 SMART
LRR_TYP 800 823 5.59e-4 SMART
LRR_TYP 824 847 7.9e-4 SMART
LRRCT 859 908 3.9e-13 SMART
EGF 921 955 3.73e-5 SMART
EGF 960 996 4.35e-6 SMART
EGF_CA 998 1034 2.21e-7 SMART
FOLN 1001 1023 5.84e1 SMART
EGF 1039 1074 1.07e-5 SMART
EGF_CA 1076 1112 3.97e-9 SMART
FOLN 1124 1146 2.22e0 SMART
EGF 1124 1157 1.62e-5 SMART
LamG 1180 1316 4.82e-39 SMART
EGF 1335 1368 3.68e-4 SMART
EGF 1374 1407 3.88e-3 SMART
FOLN 1415 1437 3.34e0 SMART
EGF 1415 1448 4.46e-3 SMART
CT 1459 1528 4.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173686
SMART Domains Protein: ENSMUSP00000133382
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
EGF 1 31 2.05e-2 SMART
EGF 43 76 1.62e-5 SMART
Pfam:Laminin_G_2 107 149 1.4e-6 PFAM
Pfam:Laminin_G_1 107 150 5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174313
AA Change: C1354*
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558
AA Change: C1354*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174421
AA Change: C1371*
SMART Domains Protein: ENSMUSP00000134263
Gene: ENSMUSG00000031558
AA Change: C1371*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 509 541 1.45e-6 SMART
LRR_TYP 561 584 1.38e-3 SMART
LRR 609 632 9.96e-1 SMART
LRR_TYP 633 656 2.71e-2 SMART
LRRCT 668 717 3.56e-7 SMART
LRRNT 730 762 3.69e-8 SMART
LRR 780 803 7.36e0 SMART
LRR_TYP 804 827 5.59e-4 SMART
LRR_TYP 828 851 7.9e-4 SMART
LRRCT 863 912 3.9e-13 SMART
EGF 925 959 3.73e-5 SMART
EGF 964 1000 4.35e-6 SMART
EGF_CA 1002 1047 4.74e-7 SMART
FOLN 1005 1027 5.84e1 SMART
EGF 1052 1087 1.07e-5 SMART
EGF_CA 1089 1125 3.97e-9 SMART
FOLN 1137 1159 2.22e0 SMART
EGF 1137 1170 1.62e-5 SMART
LamG 1193 1329 4.82e-39 SMART
EGF 1348 1381 3.68e-4 SMART
EGF 1387 1420 3.88e-3 SMART
FOLN 1428 1450 3.34e0 SMART
EGF 1428 1461 4.46e-3 SMART
CT 1472 1541 4.23e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype Strain: 2179460
FUNCTION: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and hydroureter. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adam25 C A 8: 40,754,759 A354E probably damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Slit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Slit2 APN 5 48304032 missense possibly damaging 0.86
IGL00809:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00811:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00813:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00815:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00816:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00817:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00819:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00820:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00822:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL01077:Slit2 APN 5 48217443 splice site probably null
IGL01375:Slit2 APN 5 48281714 splice site probably benign
IGL01481:Slit2 APN 5 48302931 missense probably benign 0.05
IGL01934:Slit2 APN 5 48238405 missense possibly damaging 0.93
IGL01992:Slit2 APN 5 48238417 missense probably benign 0.01
IGL02315:Slit2 APN 5 47987871 missense probably damaging 0.98
IGL02328:Slit2 APN 5 48230304 missense probably damaging 1.00
IGL02366:Slit2 APN 5 48304068 missense possibly damaging 0.53
IGL02526:Slit2 APN 5 48304223 nonsense probably null
IGL02852:Slit2 APN 5 48244672 missense probably damaging 1.00
IGL02887:Slit2 APN 5 48217474 missense probably benign 0.44
IGL03123:Slit2 APN 5 48211339 missense probably damaging 1.00
IGL03182:Slit2 APN 5 48220053 missense possibly damaging 0.77
P0025:Slit2 UTSW 5 48304035 missense probably damaging 0.96
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0267:Slit2 UTSW 5 48182331 splice site probably benign
R0552:Slit2 UTSW 5 48238379 missense probably damaging 1.00
R0610:Slit2 UTSW 5 48275674 missense possibly damaging 0.77
R0883:Slit2 UTSW 5 48245573 splice site probably benign
R1390:Slit2 UTSW 5 48217490 missense probably benign 0.06
R1442:Slit2 UTSW 5 48238383 missense probably damaging 0.96
R1453:Slit2 UTSW 5 48257051 missense possibly damaging 0.88
R1508:Slit2 UTSW 5 48192249 missense probably damaging 0.98
R1639:Slit2 UTSW 5 48259654 missense probably damaging 1.00
R1705:Slit2 UTSW 5 48189472 missense probably damaging 0.99
R1828:Slit2 UTSW 5 48304030 missense probably damaging 1.00
R1897:Slit2 UTSW 5 48238423 missense probably damaging 1.00
R1908:Slit2 UTSW 5 48281988 missense probably damaging 1.00
R1919:Slit2 UTSW 5 48191016 unclassified probably benign
R1982:Slit2 UTSW 5 48249836 missense probably damaging 1.00
R2013:Slit2 UTSW 5 48302490 missense probably damaging 1.00
R2136:Slit2 UTSW 5 48304225 missense probably benign 0.03
R2655:Slit2 UTSW 5 48189575 missense possibly damaging 0.88
R3402:Slit2 UTSW 5 48283421 missense probably damaging 0.98
R3724:Slit2 UTSW 5 48256883 critical splice donor site probably null
R4176:Slit2 UTSW 5 48237244 splice site probably null
R4306:Slit2 UTSW 5 48302783 missense possibly damaging 0.83
R4397:Slit2 UTSW 5 48220081 critical splice donor site probably null
R4525:Slit2 UTSW 5 48249873 missense probably damaging 1.00
R4688:Slit2 UTSW 5 48257003 splice site probably null
R5026:Slit2 UTSW 5 48256805 missense probably damaging 0.99
R5138:Slit2 UTSW 5 48281967 missense probably damaging 1.00
R5465:Slit2 UTSW 5 48249912 missense probably damaging 1.00
R5471:Slit2 UTSW 5 48189555 missense probably damaging 1.00
R5699:Slit2 UTSW 5 48220991 critical splice donor site probably null
R5735:Slit2 UTSW 5 48259616 missense probably damaging 1.00
R5834:Slit2 UTSW 5 48259647 missense probably damaging 1.00
R5967:Slit2 UTSW 5 47985164 missense probably damaging 0.99
R6150:Slit2 UTSW 5 48304174 missense probably damaging 1.00
R6219:Slit2 UTSW 5 48302428 missense possibly damaging 0.53
R6344:Slit2 UTSW 5 48219681 missense probably benign 0.07
R6408:Slit2 UTSW 5 47984986 unclassified probably benign
R6479:Slit2 UTSW 5 48231989 missense probably damaging 1.00
R6526:Slit2 UTSW 5 48304167 missense probably damaging 0.99
R6959:Slit2 UTSW 5 48238385 missense possibly damaging 0.83
R7139:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7201:Slit2 UTSW 5 48237285 missense probably null 0.85
R7472:Slit2 UTSW 5 48256838 missense probably damaging 0.97
R7491:Slit2 UTSW 5 48219994 missense probably benign 0.18
R7566:Slit2 UTSW 5 48249897 missense probably damaging 0.99
R7622:Slit2 UTSW 5 47985205 missense probably damaging 0.98
R7831:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7870:Slit2 UTSW 5 48302307 missense probably damaging 0.99
R7899:Slit2 UTSW 5 48247185 missense possibly damaging 0.89
R7969:Slit2 UTSW 5 48304036 missense possibly damaging 0.47
R8253:Slit2 UTSW 5 48275671 missense probably benign 0.00
R8321:Slit2 UTSW 5 48230267 missense probably damaging 1.00
R8426:Slit2 UTSW 5 48224763 missense probably benign 0.00
R8513:Slit2 UTSW 5 48224708 nonsense probably null
Z1088:Slit2 UTSW 5 48302353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCATGGCTGTATCCG -3'
(R):5'- ACACATCTTCAGGCAAGGAG -3'

Sequencing Primer
(F):5'- CCGGAACCTTTACATTAACAGTGAG -3'
(R):5'- TGGTTAAGCAAACACATGTCTG -3'
Posted On2020-01-23