Incidental Mutation 'R8021:Adam25'
ID617368
Institutional Source Beutler Lab
Gene Symbol Adam25
Ensembl Gene ENSMUSG00000071937
Gene Namea disintegrin and metallopeptidase domain 25 (testase 2)
Synonymstestase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8021 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40752208-40756176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40754759 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 354 (A354E)
Ref Sequence ENSEMBL: ENSMUSP00000094420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096663]
Predicted Effect probably damaging
Transcript: ENSMUST00000096663
AA Change: A354E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094420
Gene: ENSMUSG00000071937
AA Change: A354E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 179 3.4e-21 PFAM
Pfam:Reprolysin_5 220 398 1.6e-16 PFAM
Pfam:Reprolysin_4 220 407 2.5e-13 PFAM
Pfam:Reprolysin 221 410 5.6e-46 PFAM
Pfam:Reprolysin_2 222 399 9.7e-14 PFAM
Pfam:Reprolysin_3 246 366 1e-18 PFAM
DISIN 428 503 3.33e-39 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 706 728 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik A G 11: 107,025,927 I12V unknown Het
9130011E15Rik C T 19: 45,956,741 probably null Het
A630010A05Rik C T 16: 14,589,246 T13I Het
Acsm5 A G 7: 119,542,393 E537G possibly damaging Het
Adamts3 T C 5: 89,683,184 K1004E possibly damaging Het
Ap3d1 C A 10: 80,714,301 V699L probably benign Het
Arel1 T G 12: 84,934,958 H216P possibly damaging Het
Armc12 T A 17: 28,530,905 F8I probably benign Het
Ascc3 T A 10: 50,731,648 M1416K probably benign Het
Catsperb A C 12: 101,588,063 N672T probably benign Het
Ccdc30 T C 4: 119,352,679 H291R probably benign Het
Cd33 A G 7: 43,528,838 V371A unknown Het
Cpt1b A T 15: 89,421,426 M362K probably benign Het
Dusp5 T A 19: 53,529,498 S61T probably benign Het
Eogt T G 6: 97,134,330 D190A probably damaging Het
Fat3 T A 9: 15,999,109 I1866F probably damaging Het
Fer1l4 T A 2: 156,022,591 I1668F probably damaging Het
Foxn3 A T 12: 99,388,902 M1K probably null Het
Frs3 T A 17: 47,703,114 V244E probably damaging Het
Gm8765 A G 13: 50,701,094 N256S possibly damaging Het
Grik1 C T 16: 87,914,222 V832I Het
Gtf2ird2 T A 5: 134,203,334 V242E probably benign Het
Gtpbp2 C T 17: 46,164,269 R97C possibly damaging Het
Habp2 T A 19: 56,314,053 V263E probably benign Het
Iars2 T A 1: 185,322,457 I337L probably benign Het
Ifi204 T C 1: 173,759,353 probably benign Het
Itih2 T C 2: 10,105,652 T543A probably benign Het
Kdm2b A G 5: 122,932,919 S372P probably damaging Het
Kit T A 5: 75,615,491 V311E possibly damaging Het
Kmt2c C G 5: 25,287,119 V4230L possibly damaging Het
Lao1 T C 4: 118,968,477 I498T probably damaging Het
Lrp1 G T 10: 127,548,346 D3641E possibly damaging Het
Mapk8ip1 A T 2: 92,386,415 S477T possibly damaging Het
Mast3 C T 8: 70,788,252 G218S probably benign Het
Mical1 T C 10: 41,482,724 V546A probably damaging Het
Nck2 T C 1: 43,554,260 V209A probably benign Het
Ndufs4 A G 13: 114,307,815 probably null Het
Nek3 C T 8: 22,157,190 V139M probably damaging Het
Olfr1417 T C 19: 11,828,892 I45V probably benign Het
Olfr863-ps1 A C 9: 19,942,079 Y120* probably null Het
Olfr877 T A 9: 37,855,296 H159Q probably damaging Het
Olfr994 A T 2: 85,430,652 M59K probably damaging Het
Otog A T 7: 46,267,342 N901I probably damaging Het
Pclo A C 5: 14,539,784 Q699H unknown Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde12 A T 14: 26,665,699 Y551* probably null Het
Pigg A G 5: 108,319,939 D268G probably damaging Het
Ppp1r21 A G 17: 88,549,507 D130G probably benign Het
Psip1 T C 4: 83,459,955 T435A possibly damaging Het
Rad54l2 T C 9: 106,719,641 S189G probably benign Het
Rgs14 T C 13: 55,383,756 C498R probably damaging Het
Ripply3 C A 16: 94,328,510 A5E probably benign Het
Rps6ka4 T C 19: 6,830,409 D676G probably benign Het
Rsbn1 T C 3: 103,928,582 L312S possibly damaging Het
Secisbp2 T A 13: 51,665,628 *415R probably null Het
Sephs1 T A 2: 4,906,623 F336Y probably benign Het
Setdb2 A T 14: 59,423,384 Y103* probably null Het
Slit2 T A 5: 48,302,492 C1371* probably null Het
Stab2 C T 10: 86,905,539 A1239T possibly damaging Het
Taf4b T A 18: 14,804,524 V218E probably damaging Het
Tars2 T C 3: 95,747,514 N393S probably benign Het
Tbc1d30 A G 10: 121,267,543 M528T probably benign Het
Tchp A G 5: 114,718,417 E363G probably damaging Het
Tec T A 5: 72,757,469 N568I probably benign Het
Ticam1 A G 17: 56,270,089 S669P unknown Het
Tnk1 A G 11: 69,854,984 S372P probably benign Het
Tnpo2 G A 8: 85,055,206 A847T probably damaging Het
Tsc1 A T 2: 28,686,889 I1068F possibly damaging Het
Ttc14 T A 3: 33,809,121 Y559* probably null Het
Ttc41 C A 10: 86,733,714 T652N probably benign Het
Tut1 T A 19: 8,955,509 S69T probably benign Het
Uck1 T C 2: 32,259,917 S40G probably benign Het
Vmn2r76 G A 7: 86,225,750 T673I probably damaging Het
Vps13d G T 4: 145,148,675 P1760H Het
Zbp1 T C 2: 173,209,210 N289S possibly damaging Het
Zc3hav1l C A 6: 38,297,947 probably benign Het
Zzef1 A T 11: 72,823,416 D244V probably damaging Het
Other mutations in Adam25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adam25 APN 8 40754921 missense probably benign
IGL01977:Adam25 APN 8 40755097 missense probably benign 0.00
IGL02098:Adam25 APN 8 40755643 missense probably benign 0.12
IGL02233:Adam25 APN 8 40755386 missense probably damaging 1.00
IGL02458:Adam25 APN 8 40753807 missense probably benign 0.01
IGL02527:Adam25 APN 8 40753748 missense possibly damaging 0.78
IGL02632:Adam25 APN 8 40755200 missense possibly damaging 0.90
IGL02995:Adam25 APN 8 40753723 missense probably benign 0.00
H8786:Adam25 UTSW 8 40754224 missense probably benign 0.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0189:Adam25 UTSW 8 40755430 missense probably damaging 1.00
R0505:Adam25 UTSW 8 40755224 missense probably damaging 1.00
R0532:Adam25 UTSW 8 40755950 missense probably benign 0.00
R0699:Adam25 UTSW 8 40755974 missense probably benign
R0972:Adam25 UTSW 8 40755131 missense probably damaging 1.00
R1053:Adam25 UTSW 8 40754731 missense probably benign 0.30
R1079:Adam25 UTSW 8 40755476 missense possibly damaging 0.87
R1872:Adam25 UTSW 8 40755226 nonsense probably null
R1933:Adam25 UTSW 8 40754885 missense probably benign 0.01
R1934:Adam25 UTSW 8 40754885 missense probably benign 0.01
R4061:Adam25 UTSW 8 40753782 missense possibly damaging 0.67
R4702:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4703:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4705:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4859:Adam25 UTSW 8 40754543 missense probably benign 0.01
R5015:Adam25 UTSW 8 40754634 missense probably benign 0.22
R5249:Adam25 UTSW 8 40755954 missense probably benign
R5628:Adam25 UTSW 8 40755710 missense probably benign 0.00
R5791:Adam25 UTSW 8 40754220 missense probably benign
R6439:Adam25 UTSW 8 40754590 missense possibly damaging 0.92
R6693:Adam25 UTSW 8 40754531 missense probably damaging 1.00
R7041:Adam25 UTSW 8 40754084 missense probably benign 0.04
R7101:Adam25 UTSW 8 40755401 missense probably benign 0.00
R7531:Adam25 UTSW 8 40753877 missense probably damaging 0.99
R7600:Adam25 UTSW 8 40755817 missense probably benign 0.01
R7634:Adam25 UTSW 8 40754846 missense probably benign 0.00
R7964:Adam25 UTSW 8 40755539 missense probably damaging 0.99
R8017:Adam25 UTSW 8 40754087 missense possibly damaging 0.56
RF006:Adam25 UTSW 8 40755797 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAACCACGTGCAGGTAC -3'
(R):5'- TTCCTTGCGCATACACTTGG -3'

Sequencing Primer
(F):5'- TATGTGGAAGGCTCGCAGC -3'
(R):5'- CATACACTTGGCAGTAGCGTATG -3'
Posted On2020-01-23