Incidental Mutation 'R8213:Or4d10b'
ID 636294
Institutional Source Beutler Lab
Gene Symbol Or4d10b
Ensembl Gene ENSMUSG00000067528
Gene Name olfactory receptor family 4 subfamily D member 10B
Synonyms GA_x6K02T2RE5P-2418550-2417609, MOR239-2, Olfr1424
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12036173-12037114 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12036456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000085132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087830]
AlphaFold Q8VFV1
Predicted Effect probably benign
Transcript: ENSMUST00000087830
AA Change: V220A

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085132
Gene: ENSMUSG00000067528
AA Change: V220A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 2.4e-47 PFAM
Pfam:7tm_1 41 306 2.8e-21 PFAM
Meta Mutation Damage Score 0.1610 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Or4d10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Or4d10b APN 19 12,036,253 (GRCm39) missense possibly damaging 0.96
IGL02095:Or4d10b APN 19 12,036,913 (GRCm39) missense probably benign 0.00
IGL02743:Or4d10b APN 19 12,036,811 (GRCm39) missense probably damaging 1.00
IGL02745:Or4d10b APN 19 12,036,565 (GRCm39) missense probably benign 0.05
R0834:Or4d10b UTSW 19 12,036,979 (GRCm39) missense probably benign 0.00
R1474:Or4d10b UTSW 19 12,036,844 (GRCm39) missense probably benign 0.30
R5590:Or4d10b UTSW 19 12,036,642 (GRCm39) missense probably benign 0.01
R6386:Or4d10b UTSW 19 12,036,920 (GRCm39) missense probably damaging 0.98
R6864:Or4d10b UTSW 19 12,036,777 (GRCm39) missense probably damaging 1.00
R8207:Or4d10b UTSW 19 12,036,222 (GRCm39) missense possibly damaging 0.94
R9284:Or4d10b UTSW 19 12,036,273 (GRCm39) missense probably damaging 0.98
R9773:Or4d10b UTSW 19 12,036,939 (GRCm39) missense possibly damaging 0.94
Z1088:Or4d10b UTSW 19 12,036,493 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGTCTCCTCATGGCTGAC -3'
(R):5'- AGTGCAGATTTCTCTCTTGCTG -3'

Sequencing Primer
(F):5'- CCTGGTTCCTCAGAGTGTAGATCAAG -3'
(R):5'- TGCTGACACTTCCATTCTGTG -3'
Posted On 2020-07-13