Incidental Mutation 'R8953:Abca17'
ID 681788
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8953 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24299041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 765 (V765L)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: V765L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V765L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V765L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
Atp2b2 T A 6: 113,760,669 T915S possibly damaging Het
BC017158 T G 7: 128,273,506 Q423H probably benign Het
Cacna1s C T 1: 136,097,432 H992Y possibly damaging Het
Clpp T A 17: 56,991,373 M113K probably damaging Het
Csn3 A G 5: 87,929,950 Q105R possibly damaging Het
Dcaf1 G A 9: 106,858,343 R830Q possibly damaging Het
Dnah17 A T 11: 118,125,412 probably benign Het
Etv4 A G 11: 101,771,687 probably null Het
Fos A G 12: 85,476,052 D246G probably benign Het
Foxo1 T C 3: 52,346,254 S613P probably damaging Het
Gabra2 A T 5: 71,006,182 C261S probably damaging Het
Garem1 A T 18: 21,131,331 probably null Het
Gatsl3 A T 11: 4,221,249 I244F probably benign Het
Gm10436 A G 12: 88,177,300 C248R probably benign Het
Gmip T G 8: 69,816,777 L533R probably damaging Het
Gpr1 A G 1: 63,183,113 L321P probably damaging Het
Havcr1 A G 11: 46,756,179 T147A possibly damaging Het
Helz2 C T 2: 181,233,091 R1870Q probably damaging Het
Kcnk3 A C 5: 30,622,038 K144T probably damaging Het
Lama5 A G 2: 180,193,520 V1293A probably damaging Het
Man2b1 A G 8: 85,091,910 I498V probably benign Het
Map6 T C 7: 99,315,871 L289P probably damaging Het
Mapk7 G T 11: 61,492,966 D43E possibly damaging Het
Medag A G 5: 149,427,300 Y194C probably damaging Het
Mertk A G 2: 128,778,796 probably benign Het
Mier3 C A 13: 111,706,053 T136K probably benign Het
Ndc1 T A 4: 107,381,693 W242R probably damaging Het
Nlrp1b A G 11: 71,161,806 V932A probably damaging Het
Olfr1138 A T 2: 87,738,027 M99K probably benign Het
Olfr164 T A 16: 19,286,519 M75L probably benign Het
Olfr460 G T 6: 40,571,742 A119S possibly damaging Het
Olfr476 G A 7: 107,968,044 V216I probably benign Het
Otub2 A T 12: 103,404,326 D289V probably damaging Het
P2rx3 A G 2: 85,023,498 V133A possibly damaging Het
Pde4a C A 9: 21,210,734 T585K probably damaging Het
Pik3c2a A T 7: 116,388,085 Y534N probably benign Het
Pip5kl1 A G 2: 32,579,979 D232G possibly damaging Het
Pklr C T 3: 89,142,305 S234L probably damaging Het
Pkn1 T C 8: 83,684,186 K271E probably damaging Het
Plch1 T G 3: 63,731,705 H449P possibly damaging Het
Pparg T C 6: 115,441,546 L92P possibly damaging Het
Ptgdr2 C T 19: 10,940,422 T101I probably benign Het
Rad54l2 A T 9: 106,693,262 H1286Q probably benign Het
Ralgapa1 A G 12: 55,820,761 S3P probably damaging Het
Rictor G A 15: 6,794,447 V1598I probably benign Het
Rph3al G T 11: 75,906,575 C98* probably null Het
Rpn2 A G 2: 157,321,826 T613A probably damaging Het
Rps20 T A 4: 3,834,617 M82L probably benign Het
Sh3bp4 A G 1: 89,144,437 I336V probably damaging Het
Slc6a20b T C 9: 123,609,189 N174S probably damaging Het
Spta1 A G 1: 174,230,675 N1903S probably benign Het
Ssfa2 T C 2: 79,660,495 Y986H probably damaging Het
Tacc2 T C 7: 130,625,757 S1391P probably benign Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Trhde T A 10: 114,503,061 I615F probably damaging Het
Ttc13 T C 8: 124,675,349 N556S probably damaging Het
Ttn T A 2: 76,737,884 D19228V probably damaging Het
Unc13c T A 9: 73,932,762 Y269F probably benign Het
Usp33 T A 3: 152,374,783 V517E possibly damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Zfp318 T A 17: 46,420,430 S1120T probably benign Het
Zfr2 C A 10: 81,248,437 N650K probably damaging Het
Znfx1 G A 2: 167,055,501 T501I probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGACTATTTTGCATGTGGGC -3'
(R):5'- TCTCCTGATTCTGAAACAAGAGC -3'

Sequencing Primer
(F):5'- CATGTGGGCATGTGTAAAGG -3'
(R):5'- CCAGGTCATTACAGTTTAAACCTC -3'
Posted On 2021-08-31