Incidental Mutation 'R9388:Abca17'
ID 710454
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9388 (G1)
Quality Score 218.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24264299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1728 (S1728P)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect unknown
Transcript: ENSMUST00000039324
AA Change: S1728P
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: S1728P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121226
AA Change: S1728P
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: S1728P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,190,848 T433S probably benign Het
Abca14 A G 7: 120,283,038 D1141G probably benign Het
Adam29 A C 8: 55,872,250 C390G probably damaging Het
Angptl4 G A 17: 33,777,184 R273* probably null Het
Arfgef3 T C 10: 18,630,129 N929S probably benign Het
Baiap3 A G 17: 25,247,135 probably null Het
Btla T C 16: 45,239,091 S53P probably damaging Het
Cand1 A G 10: 119,211,308 F759S possibly damaging Het
Cbll1 T C 12: 31,491,568 T104A probably benign Het
Chd7 A G 4: 8,865,756 M2688V possibly damaging Het
Cnot3 C A 7: 3,658,368 H625Q possibly damaging Het
Dbn1 T C 13: 55,476,275 I381V probably benign Het
Dennd2d T A 3: 106,488,599 N135K possibly damaging Het
Dnah7c T C 1: 46,740,726 I3196T probably damaging Het
Dock2 C A 11: 34,262,460 R1227L possibly damaging Het
Esr1 A G 10: 4,969,179 E423G probably benign Het
Ganab A G 19: 8,914,938 Q826R probably damaging Het
Herc4 T A 10: 63,307,743 M684K probably benign Het
Hipk2 A G 6: 38,731,021 L613P probably damaging Het
Hpf1 A T 8: 60,900,148 I188L probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Kif1a C A 1: 93,072,307 probably null Het
Kng1 A T 16: 23,079,638 Y596F possibly damaging Het
Lrrc8d T A 5: 105,813,996 H757Q probably damaging Het
Med24 A T 11: 98,710,067 I600N possibly damaging Het
Mmp10 G A 9: 7,504,169 W203* probably null Het
Mnt C T 11: 74,836,624 A112V probably benign Het
Myh7b A T 2: 155,631,063 N1415Y probably benign Het
Nipal1 T A 5: 72,668,214 *417R probably null Het
Nlrp4c C T 7: 6,066,875 Q592* probably null Het
Obscn T C 11: 59,052,663 E4220G probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr129 C T 17: 38,055,257 C103Y probably damaging Het
Olfr1369-ps1 T C 13: 21,116,604 L304P probably damaging Het
Olfr537-ps1 G T 7: 140,539,015 C166F unknown Het
Pcdhb20 A T 18: 37,505,800 I460F probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Primpol G A 8: 46,581,570 T441I possibly damaging Het
Prpmp5 T C 6: 132,312,474 Q129R unknown Het
Ptprc A G 1: 138,083,642 V583A possibly damaging Het
Rfx6 T C 10: 51,678,021 V71A possibly damaging Het
Rgsl1 T C 1: 153,817,609 I574V probably benign Het
Rims3 A G 4: 120,891,355 I258V possibly damaging Het
Sec16b T C 1: 157,560,823 Y776H probably benign Het
Skint6 C T 4: 113,192,641 D276N possibly damaging Het
Slc45a1 T C 4: 150,642,610 D184G probably damaging Het
St6galnac4 A T 2: 32,589,613 S61C probably damaging Het
Stab1 C T 14: 31,154,355 V926M probably damaging Het
Stat1 A T 1: 52,153,878 K642N possibly damaging Het
Tmprss3 A G 17: 31,191,067 F191S probably damaging Het
Ube2o T C 11: 116,539,384 D1176G possibly damaging Het
Usp17ld G T 7: 103,250,938 N262K probably benign Het
Xpnpep1 T C 19: 53,004,802 K365E probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9440:Abca17 UTSW 17 24280478 missense probably benign 0.02
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTGGGAGCTGCTTTAAG -3'
(R):5'- CATGTTGGAAGACTACTCCATCAG -3'

Sequencing Primer
(F):5'- AAGAGCTGTCATCTTGACCTC -3'
(R):5'- TCAGCCAGCTATCCCTAGAGG -3'
Posted On 2022-04-18