Mutagenetix > Incidental Mutation

Incidental Mutation 'V7580:Gm4787'

69426

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

V7580 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 81377567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 606 (Q606*)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

AlphaFold

B2RUD9

Predicted Effect

probably null
Transcript: ENSMUST00000062182
AA Change: Q606*

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: Q606*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000087222

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2030:Gm4787	UTSW	12	81378770	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4038:Gm4787	UTSW	12	81378358	missense	probably damaging	1.00
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5031:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5666:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R8515:Gm4787	UTSW	12	81377269	missense	probably benign	0.00
R9103:Gm4787	UTSW	12	81378715	missense	probably benign	0.06
R9457:Gm4787	UTSW	12	81379246	missense	probably damaging	1.00
R9557:Gm4787	UTSW	12	81379300	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGTTGTTACACACCCCTCTGAAG -3'
(R):5'- ACCGTCATTTGCAGTGTCAAGCTC -3'

Sequencing Primer
(F):5'- CCCCTCTGAAGTTACATGAACTAATG -3'
(R):5'- AGTGTCAAGCTCTTTTTGGATACC -3'

Posted On

2013-09-04