Mutagenetix > Incidental Mutation

Incidental Mutation 'R9297:Skint6'

704647

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R9297 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112811520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1119 (D1119E)

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably benign
Transcript: ENSMUST00000138966
AA Change: D1119E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: D1119E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171224
AA Change: D1119E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: D1119E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,802,646	Q22R	probably benign	Het
Adamts20	A	G	15: 94,403,440	S68P	possibly damaging	Het
Adcy6	A	T	15: 98,593,585	N1044K	possibly damaging	Het
Ak9	T	G	10: 41,423,085	M1594R	unknown	Het
Alkbh3	A	G	2: 94,004,737	S88P	probably damaging	Het
Angpt1	A	G	15: 42,438,355	I419T	probably benign	Het
Ankrd31	A	T	13: 96,878,577	L1451F	probably benign	Het
Ap1b1	T	C	11: 5,040,157	I860T	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Astn2	T	C	4: 65,542,723	D1058G	possibly damaging	Het
Atg3	A	G	16: 45,167,008	H48R	possibly damaging	Het
Bnc2	A	C	4: 84,555,899		probably benign	Het
Cadps2	A	G	6: 23,496,888	Y453H	probably benign	Het
Catsperg1	T	C	7: 29,191,660	T653A	probably benign	Het
Ccdc102a	A	G	8: 94,911,492	S249P	possibly damaging	Het
Ccdc125	A	G	13: 100,696,412	Y499C	probably damaging	Het
Ccdc141	A	G	2: 77,011,684	F1468L	probably benign	Het
Ccdc162	C	A	10: 41,630,114	M893I	probably benign	Het
Ccdc33	C	A	9: 58,086,593	W335L	possibly damaging	Het
Chn2	T	A	6: 54,295,855	Y355N	probably damaging	Het
Clec4g	A	G	8: 3,716,500	M267T	probably damaging	Het
Cpa6	A	T	1: 10,484,048	D111E	possibly damaging	Het
Crlf3	A	G	11: 80,059,205	C200R	probably damaging	Het
Cyp4a10	T	C	4: 115,521,178	S164P	probably damaging	Het
Def6	A	G	17: 28,217,740	N126S	probably damaging	Het
Diaph1	G	A	18: 37,889,775	T782I	probably benign	Het
Dnah5	A	C	15: 28,203,908		probably benign	Het
Eme1	A	T	11: 94,650,788	S69R	probably benign	Het
Fat3	A	T	9: 15,997,700	D2335E	probably damaging	Het
Fstl4	A	G	11: 53,134,146	K282E	possibly damaging	Het
Galnt7	T	C	8: 57,542,521	E380G	probably damaging	Het
Gm973	A	T	1: 59,544,670	Y204F	probably damaging	Het
Hace1	T	A	10: 45,652,673	S337T	probably benign	Het
Ipo8	C	A	6: 148,801,578	C416F	possibly damaging	Het
Kcnt2	T	C	1: 140,425,195	I214T	probably damaging	Het
Kdelr3	C	A	15: 79,527,074	L203I	probably benign	Het
Kif26b	C	T	1: 178,715,809	Q336*	probably null	Het
Krt36	A	G	11: 100,103,445	Y269H	probably damaging	Het
Lamc1	G	T	1: 153,252,000	R386S	probably damaging	Het
Lipc	T	A	9: 70,820,454	D122V	probably damaging	Het
Lrba	A	G	3: 86,373,566	T1841A	probably damaging	Het
Lrit1	T	A	14: 37,062,036	D440E	probably damaging	Het
Map4	T	C	9: 110,053,412	I448T	probably benign	Het
Megf8	G	T	7: 25,331,086	C488F	probably damaging	Het
Mllt6	A	G	11: 97,672,488	E299G	probably damaging	Het
Mpst	G	T	15: 78,410,442	V125L	probably damaging	Het
Msx1	G	A	5: 37,824,412		probably benign	Het
Muc2	A	G	7: 141,749,022	E473G		Het
Myo15	A	G	11: 60,495,073	R602G	probably null	Het
Myod1	A	T	7: 46,376,932	H87L	probably damaging	Het
Nid1	T	C	13: 13,476,312	V478A	possibly damaging	Het
Obscn	A	T	11: 59,007,533	I6634N	unknown	Het
Olfr1054	A	G	2: 86,332,844	Y171H	probably benign	Het
Olfr598	T	A	7: 103,329,376	Y297N	probably damaging	Het
Olfr676	T	C	7: 105,035,623	Y142H	probably damaging	Het
Pdgfrl	C	T	8: 40,938,231	S66F	probably damaging	Het
Phf20	G	A	2: 156,273,770	R337H	probably benign	Het
Pkhd1	T	A	1: 20,222,894	Y2834F	probably benign	Het
Plekhg4	A	C	8: 105,379,275	E768A	probably damaging	Het
Prss37	A	T	6: 40,514,975	Y224N	probably damaging	Het
Ptprs	A	T	17: 56,458,257	V9E	probably damaging	Het
Ptprt	A	G	2: 161,575,778	L926S	probably benign	Het
Rgl1	G	A	1: 152,524,703	T649I	possibly damaging	Het
Serpinf1	A	G	11: 75,416,425	S29P	probably damaging	Het
Snw1	T	C	12: 87,458,904	K255E	probably damaging	Het
Sox6	T	C	7: 115,662,322	I220V	probably benign	Het
Tas2r114	A	G	6: 131,689,324	I247T	probably damaging	Het
Tmem110	T	A	14: 30,866,682	V122E	probably damaging	Het
Tmem145	C	T	7: 25,308,832	T280M	probably damaging	Het
Usp48	G	A	4: 137,613,685	G332E	probably benign	Het
Zfp219	T	C	14: 52,009,037	H211R	probably damaging	Het
Zfp42	T	C	8: 43,295,735	N243S	possibly damaging	Het
Zkscan4	T	A	13: 21,484,031	S246R	probably benign	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGAGGCTTCTGTCTATCAGCC -3'
(R):5'- TACCTCATAGTCATTCCAGGCATG -3'

Sequencing Primer
(F):5'- CTATCAGCCTTTATGCAACTCATAG -3'
(R):5'- GGCATGACACAAAAATGTTCATCTC -3'

Posted On

2022-03-25