Incidental Mutation 'R9366:Trappc9'
ID 709008
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9366 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72937088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 709 (I709V)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023276
AA Change: I530V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: I530V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: I709V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: I709V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: I709V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: I709V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170633
AA Change: I718V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: I718V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 C T 8: 71,461,684 R100Q probably benign Het
Acp5 C T 9: 22,127,928 C163Y probably damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Atp2b4 C A 1: 133,715,182 G1062C probably damaging Het
Bicral A T 17: 46,806,632 M788K possibly damaging Het
C1s2 C A 6: 124,625,735 A506S probably benign Het
Capn9 C G 8: 124,605,541 T417S probably benign Het
Cd109 T G 9: 78,714,993 S1422A probably benign Het
Cd207 G T 6: 83,671,797 N294K probably damaging Het
Cdc42bpa A G 1: 180,094,110 E605G probably damaging Het
Cdhr1 C A 14: 37,089,506 G216V possibly damaging Het
Ckap2 A T 8: 22,168,972 M585K possibly damaging Het
Clp1 G T 2: 84,726,129 S2R probably benign Het
Cngb3 G T 4: 19,395,983 V342F probably benign Het
Col18a1 T C 10: 77,096,424 D65G unknown Het
Col3a1 C T 1: 45,341,231 P972S unknown Het
Cxcr5 C T 9: 44,513,433 C309Y possibly damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dcc A T 18: 71,575,210 N478K probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Emsy A T 7: 98,641,653 N101K probably benign Het
Epb41l5 A G 1: 119,620,718 Y137H probably damaging Het
Etfdh C T 3: 79,611,964 G354D probably benign Het
Fa2h A T 8: 111,349,374 Y206N probably benign Het
Gabrr2 T C 4: 33,085,771 V217A Het
Gimap4 A G 6: 48,691,103 K264R probably benign Het
Gpr31b C A 17: 13,051,488 D265Y probably damaging Het
Irx4 A G 13: 73,268,906 T474A probably benign Het
Kif21a T C 15: 90,959,748 E1096G probably damaging Het
Letm2 A T 8: 25,594,149 V22E probably damaging Het
Lrrc45 A G 11: 120,720,726 E642G probably damaging Het
Mark1 A T 1: 184,921,595 V170E probably damaging Het
Mbd6 G A 10: 127,286,435 Q175* probably null Het
Mrc1 T A 2: 14,316,898 D1067E probably damaging Het
Muc5b A G 7: 141,863,304 H3329R probably benign Het
Myh1 A T 11: 67,219,288 D1434V probably damaging Het
Myo5a T A 9: 75,217,518 L1785Q probably damaging Het
Myrfl A G 10: 116,834,453 I295T possibly damaging Het
Nav3 C A 10: 109,823,503 R751L probably damaging Het
Neb T C 2: 52,282,687 K1536R probably benign Het
Nynrin T G 14: 55,863,130 S126A probably damaging Het
Olfr1031 A G 2: 85,992,387 D190G possibly damaging Het
Olfr1341 A T 4: 118,709,634 T76S probably damaging Het
Olfr822 A T 10: 130,075,198 K263* probably null Het
Parp14 A C 16: 35,839,260 probably null Het
Phldb1 G T 9: 44,711,249 L36M possibly damaging Het
Pin1 C A 9: 20,655,545 T81N probably damaging Het
Pkhd1l1 T C 15: 44,546,912 I2605T probably benign Het
Plcb3 A G 19: 6,960,290 probably null Het
Proser3 G A 7: 30,549,053 S72L probably damaging Het
Pum2 T A 12: 8,733,344 S598T probably benign Het
Pwp1 T A 10: 85,882,006 N269K probably damaging Het
Qsox1 A G 1: 155,789,416 S260P probably benign Het
Ric3 A G 7: 109,054,437 L149P probably damaging Het
Rif1 A G 2: 52,120,344 T707A Het
Rnf213 A C 11: 119,436,231 R1682S Het
Rpgrip1l G T 8: 91,270,181 Y690* probably null Het
Slc29a2 A G 19: 5,024,581 T34A probably damaging Het
Slc6a1 A G 6: 114,304,013 N176S possibly damaging Het
Slco1b2 T A 6: 141,656,826 Y168* probably null Het
Snca C A 6: 60,815,691 A78S probably benign Het
Snrnp200 T A 2: 127,216,090 D257E probably benign Het
Srebf2 T C 15: 82,199,636 V959A probably benign Het
Stk3 A C 15: 35,072,488 I209S probably damaging Het
Tcrg-C3 A G 13: 19,262,655 T115A probably benign Het
Thsd7a A T 6: 12,555,481 C135S Het
Tlnrd1 G T 7: 83,882,374 A283E probably benign Het
Tomm70a A T 16: 57,149,896 K546* probably null Het
Trak1 C T 9: 121,472,512 T778I probably damaging Het
Trp53rkb T C 2: 166,795,780 S219P possibly damaging Het
Ubqlnl G C 7: 104,149,385 L302V possibly damaging Het
Uqcc1 C A 2: 155,930,075 probably benign Het
Vps13a G A 19: 16,695,530 R1293W probably damaging Het
Vps9d1 G T 8: 123,247,747 S267* probably null Het
Vwa5b1 A T 4: 138,590,918 I546N probably damaging Het
Zbtb8b A T 4: 129,432,358 M338K probably benign Het
Zfp652 C T 11: 95,753,007 R344* probably null Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- TCCTGGTGACTCGGTTTCAC -3'
(R):5'- ACCTGAGCCCCAAATTCTG -3'

Sequencing Primer
(F):5'- AGTGTCCGCTCTCTACAGG -3'
(R):5'- CCCAAATTCTGTGTGTAAAGCCAGG -3'
Posted On 2022-04-18