Incidental Mutation 'R8260:Trappc9'
ID640037
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8260 (G1)
Quality Score183.009
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 72941909 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 680 (E680*)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
Predicted Effect probably null
Transcript: ENSMUST00000023276
AA Change: E501*
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: E501*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089770
AA Change: E680*
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: E680*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168191
AA Change: E680*
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: E680*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170633
AA Change: E689*
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: E689*

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik G C 14: 63,986,184 L48V probably benign Het
Acbd3 T C 1: 180,738,530 Y263H probably damaging Het
Acot4 C A 12: 84,042,035 P219Q possibly damaging Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Arid1b A G 17: 5,332,513 T1292A probably benign Het
Arntl A T 7: 113,285,051 I92F probably damaging Het
Atp2c1 T A 9: 105,418,579 I649F probably damaging Het
Bbs10 C T 10: 111,300,243 Q406* probably null Het
Bcas3 T A 11: 85,509,546 M447K possibly damaging Het
Cars T C 7: 143,585,709 D214G probably benign Het
Ccdc88a A T 11: 29,493,934 I1410F probably benign Het
Cd55b A T 1: 130,388,678 L378H probably damaging Het
Cdh1 G A 8: 106,604,347 E37K probably benign Het
Cep72 T C 13: 74,058,346 Y119C probably damaging Het
Ctnnd2 A G 15: 30,634,733 T176A possibly damaging Het
D630045J12Rik T A 6: 38,142,911 probably null Het
Ddi1 A T 9: 6,265,524 C282S probably damaging Het
Ddit4 T C 10: 59,951,455 T20A probably benign Het
Dpp10 T A 1: 123,686,295 T102S probably benign Het
Ep400 T A 5: 110,755,612 K374* probably null Het
Epha3 A G 16: 63,583,554 L728P probably damaging Het
Fbxw21 C A 9: 109,146,546 probably null Het
Frmpd1 A G 4: 45,244,638 E109G probably damaging Het
Ggt1 C T 10: 75,581,411 P332L probably damaging Het
Gm10081 A T 7: 107,106,855 M2K probably benign Het
Gm4737 T C 16: 46,154,423 E197G probably damaging Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Gm5431 A T 11: 48,894,729 I273K probably benign Het
Gm7697 A T 8: 69,519,748 D116E possibly damaging Het
Gon4l A G 3: 88,892,630 N861D probably damaging Het
Grm5 T C 7: 88,075,132 probably null Het
Helt T C 8: 46,292,708 N84S possibly damaging Het
Hnrnpa0 G T 13: 58,127,414 Y300* probably null Het
Ints1 T C 5: 139,765,213 T810A Het
Irf2bp1 C T 7: 19,006,154 A573V possibly damaging Het
Itgbl1 C A 14: 123,827,834 D133E probably benign Het
Kctd15 A G 7: 34,644,842 F128S possibly damaging Het
Klra17 T A 6: 129,831,458 N271Y probably damaging Het
Kmt2c T A 5: 25,405,516 E197D possibly damaging Het
Larp1 C A 11: 58,058,689 T1048K probably benign Het
Macf1 A G 4: 123,472,070 V2966A probably benign Het
Magi3 A G 3: 104,015,309 L1364P probably benign Het
Malrd1 T C 2: 15,614,206 S294P Het
Med13l C T 5: 118,748,729 T1565I possibly damaging Het
Mov10l1 A G 15: 89,012,110 D719G probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh14 T C 7: 44,615,376 E1654G probably damaging Het
Myo1c C T 11: 75,656,116 probably benign Het
Myo9a A G 9: 59,910,678 T2343A probably benign Het
Olfr1012 A T 2: 85,759,476 L300Q probably damaging Het
Olfr1055 T A 2: 86,346,932 Y278F possibly damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr553 T A 7: 102,614,225 I255F possibly damaging Het
Olfr669 T A 7: 104,938,672 Y49N probably damaging Het
Olfr700 A T 7: 106,806,027 V145E possibly damaging Het
Olfr734 T C 14: 50,320,158 K226E probably benign Het
Olfr791 T A 10: 129,527,088 I287N possibly damaging Het
Osmr A T 15: 6,815,416 D957E probably benign Het
Pappa T A 4: 65,316,182 V1408E probably damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pdcd6ip A T 9: 113,672,797 D464E probably benign Het
Pde1c T C 6: 56,137,419 Y503C probably benign Het
Prob1 T A 18: 35,654,157 E348V possibly damaging Het
Rnls A G 19: 33,202,648 L134S probably damaging Het
Scrn3 T C 2: 73,335,858 Y412H probably damaging Het
Serpina3g T C 12: 104,239,103 S34P probably benign Het
Sertad3 G A 7: 27,476,359 A73T probably benign Het
Sez6l C T 5: 112,461,256 A576T probably benign Het
Sh3tc2 G A 18: 62,013,066 R1172H probably damaging Het
Sirt3 A G 7: 140,876,406 V110A Het
Smpd3 A T 8: 106,257,415 D557E probably benign Het
Soga3 T A 10: 29,148,274 H395Q possibly damaging Het
Sptssb A T 3: 69,820,972 M44K probably damaging Het
Tars2 A G 3: 95,754,820 W7R probably damaging Het
Tbc1d9b A G 11: 50,164,186 D964G probably benign Het
Tiam2 A T 17: 3,518,319 D1580V possibly damaging Het
Tmeff2 T A 1: 50,938,319 V130D probably damaging Het
Top2a T A 11: 99,000,769 E1176V probably null Het
Trip10 A G 17: 57,257,314 N355S probably benign Het
Ttn T C 2: 76,765,993 E20192G probably damaging Het
Vmn2r96 A G 17: 18,583,981 M306V probably benign Het
Wdr90 A T 17: 25,845,167 H1860Q probably damaging Het
Wrnip1 A G 13: 32,805,356 I276V possibly damaging Het
Zfp608 T C 18: 54,897,749 K1040E possibly damaging Het
Zfp808 T A 13: 62,172,738 C594S probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- CGCCTTACCCAAGTCAGATG -3'
(R):5'- CTGCTGCATTTTGTCCAAGG -3'

Sequencing Primer
(F):5'- GATGAACCCCAACCGTTTGTG -3'
(R):5'- TCCAAGGACAACCAGGGTCTTTG -3'
Posted On2020-07-28