Incidental Mutation 'R1004:Hook1'
ID 97928
Institutional Source Beutler Lab
Gene Symbol Hook1
Ensembl Gene ENSMUSG00000028572
Gene Name hook microtubule tethering protein 1
Synonyms azh, A930033L17Rik, abnormal spermatozoon head shape
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 95967240-96025413 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 96022287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 713 (N713H)
Ref Sequence ENSEMBL: ENSMUSP00000030306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030306]
AlphaFold Q8BIL5
PDB Structure The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000030306
AA Change: N713H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: N713H

DomainStartEndE-ValueType
Pfam:HOOK 14 720 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156910
Meta Mutation Damage Score 0.2602 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Hook1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Hook1 APN 4 96022197 missense probably benign 0.25
IGL02229:Hook1 APN 4 96001251 missense possibly damaging 0.93
IGL03338:Hook1 APN 4 95998692 splice site probably benign
grin UTSW 4 96013312 frame shift probably null
toothy UTSW 4 96014805 splice site probably null
PIT4453001:Hook1 UTSW 4 96014852 missense probably damaging 0.99
R0558:Hook1 UTSW 4 95993212 splice site probably benign
R0593:Hook1 UTSW 4 95998786 missense possibly damaging 0.93
R0699:Hook1 UTSW 4 95995840 splice site probably benign
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R2140:Hook1 UTSW 4 96013312 frame shift probably null
R2278:Hook1 UTSW 4 95998720 missense probably benign 0.00
R3784:Hook1 UTSW 4 95989651 missense probably damaging 1.00
R4500:Hook1 UTSW 4 95993200 critical splice donor site probably null
R4798:Hook1 UTSW 4 96002557 missense possibly damaging 0.84
R5200:Hook1 UTSW 4 95993130 missense probably damaging 1.00
R5546:Hook1 UTSW 4 96002528 missense probably benign 0.03
R6532:Hook1 UTSW 4 96019756 splice site probably null
R6629:Hook1 UTSW 4 96001270 missense probably benign 0.03
R7010:Hook1 UTSW 4 96014811 missense probably damaging 0.99
R7534:Hook1 UTSW 4 96017597 missense probably benign 0.27
R8236:Hook1 UTSW 4 96014805 splice site probably null
R8826:Hook1 UTSW 4 95992195 missense probably benign 0.00
R8985:Hook1 UTSW 4 96022231 missense probably benign 0.00
R9288:Hook1 UTSW 4 96013268 missense probably damaging 1.00
X0027:Hook1 UTSW 4 95995811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAGCATTAGCCAGCTAGAACTGC -3'
(R):5'- TACTCCAATGTCCTGCCCAGAGAC -3'

Sequencing Primer
(F):5'- AGCCTGGCGTTTCAGAAA -3'
(R):5'- aacacactgtcatttctatgcc -3'
Posted On 2014-01-05