Incidental Mutation 'R1004:Zfp235'
ID97952
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Namezinc finger protein 235
Synonyms
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1004 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24134169-24143241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24140744 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 266 (L266Q)
Ref Sequence ENSEMBL: ENSMUSP00000145993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056549
AA Change: L196Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603
AA Change: L196Q

DomainStartEndE-ValueType
KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205680
AA Change: L266Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206809
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 24137080 missense probably damaging 1.00
IGL02326:Zfp235 APN 7 24135302 start codon destroyed probably null 0.98
R0107:Zfp235 UTSW 7 24137116 missense probably damaging 1.00
R0271:Zfp235 UTSW 7 24137131 missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 24142219 missense probably damaging 1.00
R1928:Zfp235 UTSW 7 24141138 nonsense probably null
R1958:Zfp235 UTSW 7 24140346 missense probably damaging 0.98
R2167:Zfp235 UTSW 7 24140962 missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 24142124 missense probably damaging 1.00
R3013:Zfp235 UTSW 7 24140732 missense probably damaging 0.98
R3806:Zfp235 UTSW 7 24140621 missense probably benign 0.01
R4613:Zfp235 UTSW 7 24141676 missense probably damaging 1.00
R4876:Zfp235 UTSW 7 24140959 missense probably benign 0.01
R4977:Zfp235 UTSW 7 24142184 missense possibly damaging 0.94
R5085:Zfp235 UTSW 7 24137121 missense probably damaging 0.96
R5664:Zfp235 UTSW 7 24142151 missense probably damaging 1.00
R6440:Zfp235 UTSW 7 24140615 missense probably damaging 0.96
R6650:Zfp235 UTSW 7 24137038 splice site probably null
R7694:Zfp235 UTSW 7 24142100 missense probably benign 0.37
R8031:Zfp235 UTSW 7 24141689 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACAAGCGATCATTCCAGCATTACCG -3'
(R):5'- AGCCTTGCCACACTCTTGACAC -3'

Sequencing Primer
(F):5'- TTCCAGCATTACCGAAAATCAGG -3'
(R):5'- GGACTTATTTCCTAAGAGGACCTGC -3'
Posted On2014-01-05