Incidental Mutation 'R1004:Slc22a6'
ID 98013
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Name solute carrier family 22 (organic anion transporter), member 6
Synonyms NKT, Oat1, mOat1, Orctl1
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1004 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 8617996-8628299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8618399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 35 (N35S)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
AlphaFold Q8VC69
Predicted Effect probably damaging
Transcript: ENSMUST00000010250
AA Change: N35S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: N35S

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Meta Mutation Damage Score 0.1635 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Serpinb9f TA "TTTNA,T" 13: 33,334,242 probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8621868 missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8618357 missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8621208 missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8626214 utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8623616 missense possibly damaging 0.79
R1775:Slc22a6 UTSW 19 8619107 critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8621882 missense probably benign
R2365:Slc22a6 UTSW 19 8619397 missense probably benign
R3406:Slc22a6 UTSW 19 8621311 missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8618510 missense probably benign
R4693:Slc22a6 UTSW 19 8623652 missense probably damaging 1.00
R5094:Slc22a6 UTSW 19 8626177 missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8618553 missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8619422 missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8621784 critical splice acceptor site probably null
R5810:Slc22a6 UTSW 19 8623858 missense probably damaging 1.00
R6176:Slc22a6 UTSW 19 8621797 missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8622130 missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8618441 missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8622096 missense probably benign 0.02
R7298:Slc22a6 UTSW 19 8621320 missense possibly damaging 0.49
R7305:Slc22a6 UTSW 19 8622158 critical splice donor site probably null
R7681:Slc22a6 UTSW 19 8626129 missense probably benign 0.03
R7749:Slc22a6 UTSW 19 8621896 missense possibly damaging 0.48
R7937:Slc22a6 UTSW 19 8623889 missense probably benign 0.07
R8346:Slc22a6 UTSW 19 8621805 missense probably damaging 1.00
R8347:Slc22a6 UTSW 19 8621805 missense probably damaging 1.00
R8348:Slc22a6 UTSW 19 8621805 missense probably damaging 1.00
R8363:Slc22a6 UTSW 19 8619022 missense probably benign
R8698:Slc22a6 UTSW 19 8623525 missense probably benign
R9431:Slc22a6 UTSW 19 8621232 missense probably benign 0.10
Z1088:Slc22a6 UTSW 19 8621833 missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8623543 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGACAAAGATTAAACGCTGCCTGC -3'
(R):5'- ATTGGCCTCTGTGCCATTGTGC -3'

Sequencing Primer
(F):5'- TTAAACGCTGCCTGCGTAAG -3'
(R):5'- TGCCATTGTGCGGGAAAG -3'
Posted On 2014-01-05