Mutagenetix > Incidental Mutations

Incidental Mutation 'R1647:Vmn2r111'

173984

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

039683-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R1647 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22569061 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 436 (D436E)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: D436E

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: D436E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

97% (70/72)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,571	S184P	probably damaging	Het
Adgb	A	G	10: 10,395,371	F817L	probably damaging	Het
Anxa10	T	C	8: 62,092,584	D38G	probably damaging	Het
Atp8b2	G	A	3: 89,941,784	A1081V	probably benign	Het
Baz1a	G	A	12: 54,975,198	R100C	probably damaging	Het
Ceacam18	A	C	7: 43,639,265	T147P	possibly damaging	Het
Cep170b	C	T	12: 112,736,372	T423I	probably damaging	Het
Chd6	A	G	2: 161,042,058	L89S	probably damaging	Het
Chrm3	A	T	13: 9,878,425	W192R	probably damaging	Het
Cnn1	C	A	9: 22,107,854	A202E	probably damaging	Het
Dcaf7	T	A	11: 106,051,802	F192I	probably damaging	Het
Eif2b5	T	C	16: 20,502,585	V296A	possibly damaging	Het
Entpd7	A	G	19: 43,721,745		probably benign	Het
Esr1	A	G	10: 5,001,260	E546G	possibly damaging	Het
Etaa1	C	A	11: 17,946,492	G542C	probably damaging	Het
Exosc8	A	T	3: 54,734,101		probably null	Het
Fras1	T	A	5: 96,726,613		probably null	Het
G930045G22Rik	T	C	6: 50,846,718		noncoding transcript	Het
Gm22697+Rbm27	AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC	AGGTCCCGGCCCAGGCCC	18: 42,301,883		probably benign	Het
Gm5615	A	G	9: 36,534,440	S72P	possibly damaging	Het
Gpr155	T	C	2: 73,364,164		probably null	Het
Has1	A	G	17: 17,849,985	Y225H	probably damaging	Het
Hk3	A	G	13: 55,014,461	F110S	probably damaging	Het
Iars	A	G	13: 49,723,002	K848E	possibly damaging	Het
Il22ra1	C	A	4: 135,750,460	H281N	probably damaging	Het
Inpp4b	G	T	8: 81,856,774		probably benign	Het
Itga11	A	G	9: 62,760,370	N662D	probably benign	Het
Kif20b	A	T	19: 34,936,790	T355S	possibly damaging	Het
Kif21a	T	C	15: 90,994,367	T237A	probably damaging	Het
Klc1	T	C	12: 111,776,887	L216P	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama3	A	G	18: 12,532,199	D2330G	possibly damaging	Het
Lamb2	G	A	9: 108,481,423		probably null	Het
Limch1	T	A	5: 66,999,256	S511R	probably damaging	Het
Lnx2	C	A	5: 147,027,342	V468L	probably benign	Het
Lrriq1	A	T	10: 103,170,648	C1205*	probably null	Het
Lsm4	A	G	8: 70,677,806	Y25C	probably damaging	Het
Macc1	T	C	12: 119,446,421	M308T	probably benign	Het
Miip	T	C	4: 147,865,234	S174G	probably benign	Het
Mroh9	T	G	1: 163,046,056	E510A	probably damaging	Het
Msh2	C	T	17: 87,672,636	A14V	probably benign	Het
Nbea	T	A	3: 55,630,229	I2828F	probably damaging	Het
Nkx2-3	A	T	19: 43,614,456	Q167L	probably damaging	Het
Nup160	T	C	2: 90,710,088	Y854H	probably damaging	Het
Olfr1436	T	A	19: 12,298,659	I158L	probably benign	Het
Olfr519	A	G	7: 108,893,765	I214T	probably damaging	Het
Olfr642	A	G	7: 104,050,169	Y62H	probably damaging	Het
Phldb1	G	A	9: 44,715,433	P572S	probably damaging	Het
Plcb2	A	T	2: 118,723,780	M64K	possibly damaging	Het
Prr12	T	A	7: 45,034,192	N1683Y	probably benign	Het
Prrg4	C	A	2: 104,832,743	A173S	probably benign	Het
Pygl	T	A	12: 70,197,010	I553F	possibly damaging	Het
Rasd1	T	C	11: 59,964,094	M187V	probably benign	Het
Rasgrf1	A	G	9: 89,953,920	I234V	probably benign	Het
Rps6ka4	C	A	19: 6,839,362	V118L	probably benign	Het
Sbspon	C	A	1: 15,883,759	R99L	probably damaging	Het
Sdhaf3	T	C	6: 6,956,126	Y34H	probably damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc2	T	A	10: 79,626,111	M367L	probably benign	Het
Slc26a5	T	A	5: 21,813,976	K590*	probably null	Het
Slc39a12	T	C	2: 14,451,992	V597A	probably benign	Het
Slc45a3	G	A	1: 131,977,524	G81D	probably damaging	Het
Spata2l	T	C	8: 123,233,302	N416S	probably benign	Het
Tdrd6	A	C	17: 43,627,109	V1016G	possibly damaging	Het
Tet2	A	G	3: 133,485,880	V931A	probably benign	Het
Tmem190	A	G	7: 4,784,121	D108G	probably damaging	Het
Trip11	T	A	12: 101,884,392	K853*	probably null	Het
Zfp704	A	T	3: 9,471,039	S140R	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGTTGACCATTTGGAAGATAGGGAC -3'
(R):5'- CCAGCATATTGCCCATAAAGTTGCC -3'

Sequencing Primer
(F):5'- TTTGGAAGATAGGGACTAAACATCC -3'
(R):5'- gcccattggacacacaaac -3'

Posted On

2014-04-24