Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Adgrb3'

487606

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.468) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25067476-25829707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25094370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 972 (I972L)

Ref Sequence

ENSEMBL: ENSMUSP00000116759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

AlphaFold

Q80ZF8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041838
AA Change: I1212L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: I1212L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126096

Predicted Effect

probably benign
Transcript: ENSMUST00000126626
AA Change: I342L

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: I342L

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	273	7.3e-65	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135518
AA Change: I1212L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: I1212L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146592
AA Change: I972L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: I972L

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151309
AA Change: I1212L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: I1212L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153568

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976 (GRCm38)	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034 (GRCm38)	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718 (GRCm38)	D352E	probably benign	Het
Alg3	T	C	16: 20,610,641 (GRCm38)	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752 (GRCm38)	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239 (GRCm38)	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604 (GRCm38)	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790 (GRCm38)	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568 (GRCm38)		probably benign	Het
Dnah12	T	A	14: 26,861,769 (GRCm38)	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258 (GRCm38)	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325 (GRCm38)	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317 (GRCm38)	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877 (GRCm38)	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644 (GRCm38)	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998 (GRCm38)		probably null	Het
Hnrnpll	A	G	17: 80,049,876 (GRCm38)	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868 (GRCm38)	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030 (GRCm38)	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436 (GRCm38)	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124 (GRCm38)	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923 (GRCm38)	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108 (GRCm38)	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787 (GRCm38)	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553 (GRCm38)	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685 (GRCm38)	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229 (GRCm38)	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232 (GRCm38)	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731 (GRCm38)	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262 (GRCm38)	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852 (GRCm38)	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129 (GRCm38)		probably benign	Het
Rgl1	C	T	1: 152,586,570 (GRCm38)	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491 (GRCm38)	W21R	probably benign	Het
Spast	A	G	17: 74,373,358 (GRCm38)	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417 (GRCm38)		probably benign	Het
Sry	C	G	Y: 2,662,975 (GRCm38)	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541 (GRCm38)	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425 (GRCm38)	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791 (GRCm38)	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757 (GRCm38)	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666 (GRCm38)	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245 (GRCm38)	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290 (GRCm38)	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069 (GRCm38)	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558 (GRCm38)	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930 (GRCm38)	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370 (GRCm38)	I633N	possibly damaging	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25,228,500 (GRCm38)	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25,074,715 (GRCm38)	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25,488,119 (GRCm38)	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25,093,787 (GRCm38)	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25,112,271 (GRCm38)	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25,112,171 (GRCm38)	splice site	probably null
IGL01608:Adgrb3	APN	1	25,553,774 (GRCm38)	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25,559,751 (GRCm38)	splice site	probably benign
IGL01657:Adgrb3	APN	1	25,826,493 (GRCm38)	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25,460,751 (GRCm38)	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25,826,279 (GRCm38)	missense	probably benign
IGL01767:Adgrb3	APN	1	25,559,814 (GRCm38)	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25,101,431 (GRCm38)	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25,420,550 (GRCm38)	splice site	probably benign
IGL02584:Adgrb3	APN	1	25,504,984 (GRCm38)	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25,084,242 (GRCm38)	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25,504,910 (GRCm38)	splice site	probably null
IGL02929:Adgrb3	APN	1	25,553,824 (GRCm38)	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25,531,897 (GRCm38)	nonsense	probably null
IGL03165:Adgrb3	APN	1	25,094,394 (GRCm38)	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25,547,475 (GRCm38)	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25,504,448 (GRCm38)	missense	probably damaging	0.99
schwach	UTSW	1	25,111,691 (GRCm38)	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25,111,691 (GRCm38)	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25,101,482 (GRCm38)	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25,101,482 (GRCm38)	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25,221,748 (GRCm38)	splice site	probably benign
R0442:Adgrb3	UTSW	1	25,396,470 (GRCm38)	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25,547,554 (GRCm38)	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25,826,199 (GRCm38)	missense	probably benign
R1252:Adgrb3	UTSW	1	25,128,828 (GRCm38)	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25,559,850 (GRCm38)	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25,488,088 (GRCm38)	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25,094,183 (GRCm38)	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25,094,072 (GRCm38)	missense	possibly damaging	0.94
R1583:Adgrb3	UTSW	1	25,226,831 (GRCm38)	splice site	probably null
R1653:Adgrb3	UTSW	1	25,101,503 (GRCm38)	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25,826,300 (GRCm38)	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25,228,471 (GRCm38)	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25,532,577 (GRCm38)	missense	probably damaging	0.99
R1838:Adgrb3	UTSW	1	25,084,270 (GRCm38)	missense	probably damaging	1.00
R1869:Adgrb3	UTSW	1	25,826,438 (GRCm38)	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25,547,444 (GRCm38)	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25,111,718 (GRCm38)	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25,093,957 (GRCm38)	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25,068,209 (GRCm38)	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25,111,817 (GRCm38)	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25,826,454 (GRCm38)	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25,111,825 (GRCm38)	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25,094,307 (GRCm38)	nonsense	probably null
R4344:Adgrb3	UTSW	1	25,826,748 (GRCm38)	missense	possibly damaging	0.61
R4363:Adgrb3	UTSW	1	25,112,222 (GRCm38)	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25,831,027 (GRCm38)	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25,094,366 (GRCm38)	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25,111,748 (GRCm38)	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25,084,279 (GRCm38)	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25,084,279 (GRCm38)	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25,826,488 (GRCm38)	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25,547,532 (GRCm38)	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25,531,875 (GRCm38)	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25,221,827 (GRCm38)	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25,074,779 (GRCm38)	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25,068,128 (GRCm38)	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25,826,084 (GRCm38)	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25,093,952 (GRCm38)	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25,111,790 (GRCm38)	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25,094,275 (GRCm38)	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25,128,859 (GRCm38)	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25,420,559 (GRCm38)	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25,826,562 (GRCm38)	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25,431,501 (GRCm38)	splice site	probably null
R6006:Adgrb3	UTSW	1	25,826,531 (GRCm38)	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25,094,000 (GRCm38)	nonsense	probably null
R6190:Adgrb3	UTSW	1	25,420,647 (GRCm38)	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25,432,558 (GRCm38)	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25,111,718 (GRCm38)	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25,420,602 (GRCm38)	missense	probably benign
R6678:Adgrb3	UTSW	1	25,460,810 (GRCm38)	missense	possibly damaging	0.84
R6679:Adgrb3	UTSW	1	25,131,296 (GRCm38)	missense	probably benign	0.01
R6685:Adgrb3	UTSW	1	25,111,736 (GRCm38)	nonsense	probably null
R6730:Adgrb3	UTSW	1	25,094,294 (GRCm38)	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25,826,172 (GRCm38)	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25,093,922 (GRCm38)	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25,111,771 (GRCm38)	nonsense	probably null
R6953:Adgrb3	UTSW	1	25,826,511 (GRCm38)	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25,826,085 (GRCm38)	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25,131,269 (GRCm38)	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25,531,876 (GRCm38)	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25,532,630 (GRCm38)	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25,531,919 (GRCm38)	nonsense	probably null
R7489:Adgrb3	UTSW	1	25,547,505 (GRCm38)	missense	probably damaging	1.00
R7615:Adgrb3	UTSW	1	25,098,897 (GRCm38)	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25,547,548 (GRCm38)	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25,432,544 (GRCm38)	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25,128,834 (GRCm38)	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25,420,556 (GRCm38)	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25,221,757 (GRCm38)	splice site	probably null
R8161:Adgrb3	UTSW	1	25,093,922 (GRCm38)	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25,826,516 (GRCm38)	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25,488,053 (GRCm38)	missense	probably benign	0.21
R8694:Adgrb3	UTSW	1	25,826,391 (GRCm38)	missense	probably damaging	0.98
R8742:Adgrb3	UTSW	1	25,226,754 (GRCm38)	missense	probably benign	0.01
R8886:Adgrb3	UTSW	1	25,111,847 (GRCm38)	missense	probably damaging	1.00
R8941:Adgrb3	UTSW	1	25,094,154 (GRCm38)	missense	probably damaging	1.00
R8958:Adgrb3	UTSW	1	25,826,109 (GRCm38)	missense	possibly damaging	0.68
R8979:Adgrb3	UTSW	1	25,488,034 (GRCm38)	missense	probably benign	0.03
R9064:Adgrb3	UTSW	1	25,531,884 (GRCm38)	missense	possibly damaging	0.86
R9252:Adgrb3	UTSW	1	25,826,415 (GRCm38)	missense	probably benign	0.03
R9401:Adgrb3	UTSW	1	25,553,702 (GRCm38)	missense	probably damaging	1.00
R9739:Adgrb3	UTSW	1	25,553,768 (GRCm38)	missense	probably damaging	1.00
Z1088:Adgrb3	UTSW	1	25,131,271 (GRCm38)	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25,093,914 (GRCm38)	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TCAGACACGGATTGCTTAGCTC -3'
(R):5'- TGATCTCTGGTACCATTAGAACATC -3'

Sequencing Primer
(F):5'- CGTTCATACTCATAGGCATGTGCAG -3'
(R):5'- CAATTCAGTAATCTGGACCATGAAC -3'

Posted On

2017-10-10