Incidental Mutation 'R0081:Dennd5b'
ID19674
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R0081 (G1)
Quality Score123
Status Validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148993759 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1258 (Q1258K)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: Q1258K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: Q1258K

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181858
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr344 T A 2: 36,568,881 Y94* probably null Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1255:Dennd5b UTSW 6 149041650 missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 intron probably null
R5400:Dennd5b UTSW 6 149000016 missense probably damaging 1.00
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5548:Dennd5b UTSW 6 149019349 synonymous probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6556:Dennd5b UTSW 6 149014251 splice site probably null
R6812:Dennd5b UTSW 6 149081132 start gained probably benign
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
R7104:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7231:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7325:Dennd5b UTSW 6 149020570 missense probably benign 0.00
R7399:Dennd5b UTSW 6 149036483 missense probably damaging 1.00
R7516:Dennd5b UTSW 6 149068380 missense probably benign 0.02
R7751:Dennd5b UTSW 6 149017106 missense probably benign 0.01
R7763:Dennd5b UTSW 6 149068658 missense probably damaging 1.00
R7770:Dennd5b UTSW 6 149041716 missense probably damaging 0.99
R7788:Dennd5b UTSW 6 149068566 missense probably benign 0.00
R7854:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7899:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
R7937:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7982:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTGTGAGACCTGGAGGGAAA -3'
(R):5'- GGGGAGCCAGTTACACTGTATCTGT -3'

Sequencing Primer
(F):5'- AAAGAAGCCTTCCTGGGTTG -3'
(R):5'- GCCAGTTACACTGTATCTGTTAGAG -3'
Posted On2013-04-11