Incidental Mutation 'R1886:Ap2b1'
ID209567
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Nameadaptor-related protein complex 2, beta 1 subunit
Synonyms1300012O03Rik
MMRRC Submission 039907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1886 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83299024-83405035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83390735 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 822 (N822K)
Ref Sequence ENSEMBL: ENSMUSP00000135445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
Predicted Effect probably benign
Transcript: ENSMUST00000018875
AA Change: N860K

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: N860K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
AA Change: N846K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: N846K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176430
AA Change: N860K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: N860K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176523
AA Change: N822K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: N822K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,801,831 N208S probably benign Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acacb T A 5: 114,218,959 L1317Q probably damaging Het
Acsf3 T C 8: 122,784,002 V293A probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
Ahnak G A 19: 9,015,979 D4876N probably damaging Het
Arhgdia T C 11: 120,579,418 D143G probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bcl9 G T 3: 97,215,397 R29S probably benign Het
Bhmt2 T A 13: 93,662,490 K274N probably benign Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cit A G 5: 115,933,486 Y584C probably damaging Het
Crebl2 T C 6: 134,851,096 M77T probably benign Het
Dach2 G A X: 113,298,608 G61D probably benign Het
Ddx4 A T 13: 112,622,665 D237E probably damaging Het
Dgcr8 A G 16: 18,278,354 I490T possibly damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Dnah17 T A 11: 118,108,161 I929F possibly damaging Het
Eif3f A G 7: 108,940,751 T289A probably benign Het
Ercc5 A T 1: 44,175,976 K890* probably null Het
Esrp2 A T 8: 106,133,857 V247E probably damaging Het
Evpl C T 11: 116,227,576 G735E probably damaging Het
Fbxl21 A G 13: 56,527,093 I60V probably benign Het
Frem3 A G 8: 80,613,885 I936V probably benign Het
Fsd1l T C 4: 53,696,984 probably null Het
Gad1-ps T C 10: 99,445,582 noncoding transcript Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm11397 C T 13: 33,404,220 R263C possibly damaging Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gm7102 A G 19: 61,175,698 F100L probably damaging Het
Gmppa T C 1: 75,442,508 V353A probably damaging Het
Hmcn1 T C 1: 150,577,295 E5423G probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Krt12 T C 11: 99,418,576 D286G probably damaging Het
Krt75 A T 15: 101,571,097 M266K probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Lag3 T C 6: 124,909,439 N184D probably damaging Het
Lsm10 C G 4: 126,097,948 D32E probably benign Het
Mettl5 A G 2: 69,880,805 V123A probably damaging Het
Mfrp A G 9: 44,103,488 D274G possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mttp A T 3: 138,092,615 V840D probably damaging Het
Nadk2 A C 15: 9,103,358 N308H possibly damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlk T A 11: 78,586,928 I330F probably damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Olfr498 A T 7: 108,465,740 M139L probably benign Het
Orc2 T C 1: 58,471,088 probably null Het
Orc3 A G 4: 34,584,829 Y459H probably damaging Het
Pah T A 10: 87,528,328 N30K possibly damaging Het
Pcsk4 T C 10: 80,328,960 K74E probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pfkm A G 15: 98,127,746 N547S probably damaging Het
Por A G 5: 135,734,274 E546G probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Prdm1 T A 10: 44,439,758 D794V probably damaging Het
Prdx5 A G 19: 6,908,190 I32T probably benign Het
Prlhr G T 19: 60,467,494 C211* probably null Het
Ripk3 C T 14: 55,788,237 probably null Het
Rmnd5b G A 11: 51,627,638 A137V probably damaging Het
Rwdd2b A T 16: 87,437,125 F72I probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Sept1 A G 7: 127,214,765 probably benign Het
Slc30a10 T A 1: 185,462,864 I291N probably damaging Het
Slc7a9 T G 7: 35,453,402 C20W possibly damaging Het
Slc7a9 G C 7: 35,453,403 A21P probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Sra1 T C 18: 36,668,777 M87V probably benign Het
Syvn1 T C 19: 6,049,227 S169P possibly damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tmem62 A T 2: 120,986,670 I236F probably damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Trpa1 T C 1: 14,889,425 D679G probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc22 T A 4: 106,636,866 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyrp1 T A 4: 80,840,806 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp36 A T 11: 118,272,958 Y255N probably damaging Het
Zfp944 A T 17: 22,339,979 Y96N probably benign Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83333158 missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83324611 missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83321973 missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83335530 missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83346766 missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83336799 missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83341384 missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83368026 missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83321967 missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83367874 splice site probably benign
R1222:Ap2b1 UTSW 11 83346738 missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83333109 missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83346831 missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83324604 missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83336386 missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83351118 missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83324761 splice site probably benign
R3615:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83390716 missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83342603 missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83335604 critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83324650 missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83397779 missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83333011 nonsense probably null
R4916:Ap2b1 UTSW 11 83390706 missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83339392 missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83342601 missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83336737 intron probably null
R5738:Ap2b1 UTSW 11 83336430 unclassified probably null
R6023:Ap2b1 UTSW 11 83335398 missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83346673 missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83346825 missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83308239 start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83342679 missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83335491 missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83389726 missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83333122 missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83351105 missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83367998 missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83324522 missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83389728 missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83339430 critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83367907 nonsense probably null
X0064:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCCAACATCACCCATAGG -3'
(R):5'- GCATTTAACATGTGACCCACC -3'

Sequencing Primer
(F):5'- CCAGTGTGTGTTCTAGTTCAATCAAG -3'
(R):5'- GTGACCCACCACAATCATGTTAAATG -3'
Posted On2014-06-30