Mutagenetix > Incidental Mutation

Incidental Mutation 'R1906:Ncor1'

214391

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

Rxrip13, 5730405M06Rik, A230020K14Rik, N-CoR

MMRRC Submission

039925-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1906 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62207132-62348200 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62240211 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 920 (M920K)

Ref Sequence

ENSEMBL: ENSMUSP00000125317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018645
AA Change: M1272K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: M1272K

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000037575

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101066
AA Change: M1272K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: M1272K

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101067

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151498
AA Change: M920K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501
AA Change: M920K

Domain	Start	End	E-Value	Type
SANT	37	85	2.76e-7	SMART
coiled coil region	107	144	N/A	INTRINSIC
low complexity region	193	217	N/A	INTRINSIC
SANT	224	272	3.29e-14	SMART
low complexity region	316	337	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	577	585	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
internal_repeat_2	700	830	5.77e-7	PROSPERO
internal_repeat_2	855	961	5.77e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000155712

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156740

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161116

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	G	A	6: 23,072,984 (GRCm39)	T923I	probably benign	Het
Abhd13	T	A	8: 10,038,170 (GRCm39)	C256S	probably benign	Het
Adamts5	C	T	16: 85,665,573 (GRCm39)	W576*	probably null	Het
Adnp	A	T	2: 168,024,287 (GRCm39)	S1003T	probably benign	Het
AI987944	C	T	7: 41,024,550 (GRCm39)	R146Q	probably benign	Het
Apol6	G	T	15: 76,935,060 (GRCm39)	V110F	probably damaging	Het
Arhgap27	A	G	11: 103,223,751 (GRCm39)	F651L	probably damaging	Het
Atm	T	C	9: 53,417,868 (GRCm39)	D813G	probably damaging	Het
Casd1	T	A	6: 4,641,979 (GRCm39)	I752N	probably damaging	Het
Cdr2	A	G	7: 120,581,224 (GRCm39)	Y18H	probably damaging	Het
Cntn4	T	C	6: 106,330,607 (GRCm39)	F75S	probably benign	Het
Col20a1	G	A	2: 180,640,490 (GRCm39)	R549H	probably benign	Het
Col28a1	A	T	6: 7,999,644 (GRCm39)	N1024K	probably benign	Het
Dnah10	T	A	5: 124,878,048 (GRCm39)	V2654D	probably damaging	Het
Dnph1	A	T	17: 46,807,787 (GRCm39)	I18F	probably damaging	Het
Dsn1	G	A	2: 156,838,163 (GRCm39)	R334W	probably damaging	Het
Egf	T	A	3: 129,518,873 (GRCm39)	K325N	probably benign	Het
Eps15	T	G	4: 109,181,398 (GRCm39)	S311A	possibly damaging	Het
Fmo3	G	T	1: 162,794,475 (GRCm39)	D198E	probably damaging	Het
Folh1	C	G	7: 86,391,374 (GRCm39)		probably null	Het
Foxn1	A	G	11: 78,262,636 (GRCm39)		probably null	Het
Gm10604	T	G	4: 11,979,989 (GRCm39)	D105A	unknown	Het
Gpx8	A	G	13: 113,182,110 (GRCm39)	C108R	probably damaging	Het
Herc2	A	T	7: 55,764,612 (GRCm39)	I1013L	probably benign	Het
Hyal4	T	G	6: 24,756,110 (GRCm39)	N109K	probably damaging	Het
Il22ra1	T	G	4: 135,478,544 (GRCm39)	C538W	probably damaging	Het
Ints13	A	T	6: 146,453,868 (GRCm39)		probably null	Het
Krt75	T	A	15: 101,481,801 (GRCm39)	T156S	possibly damaging	Het
Lama2	A	C	10: 26,932,523 (GRCm39)		probably null	Het
Lifr	G	T	15: 7,217,612 (GRCm39)	V847L	probably damaging	Het
Lmf1	T	A	17: 25,831,309 (GRCm39)	I185N	probably damaging	Het
Mast1	G	A	8: 85,642,895 (GRCm39)	R967C	probably damaging	Het
Ms4a15	T	C	19: 10,960,644 (GRCm39)	I94V	probably benign	Het
Mycbpap	A	T	11: 94,396,447 (GRCm39)	M131K	probably benign	Het
Neb	A	G	2: 52,198,538 (GRCm39)	Y437H	probably damaging	Het
Npy5r	A	T	8: 67,134,125 (GRCm39)	W223R	probably damaging	Het
Or10ak11	G	A	4: 118,687,467 (GRCm39)	H56Y	probably damaging	Het
Or10x4	C	A	1: 174,218,730 (GRCm39)	L32M	probably damaging	Het
Or4c114	A	G	2: 88,905,414 (GRCm39)	V7A	possibly damaging	Het
Or6c6c	T	G	10: 129,541,365 (GRCm39)	V206G	probably benign	Het
Polg	T	C	7: 79,110,070 (GRCm39)	K353E	probably damaging	Het
Proz	C	G	8: 13,123,686 (GRCm39)		probably null	Het
Pus7	T	C	5: 23,983,209 (GRCm39)	D86G	probably damaging	Het
Rhpn1	T	C	15: 75,583,673 (GRCm39)	V386A	probably benign	Het
Rigi	T	C	4: 40,206,054 (GRCm39)	K846R	probably benign	Het
Sptbn4	A	G	7: 27,090,856 (GRCm39)		probably null	Het
Srp68	A	T	11: 116,141,587 (GRCm39)	I424N	probably damaging	Het
Stard9	A	G	2: 120,526,908 (GRCm39)	E1055G	probably benign	Het
Taf4b	A	G	18: 14,955,159 (GRCm39)	I571V	probably benign	Het
Tas2r107	T	C	6: 131,636,951 (GRCm39)	M33V	probably benign	Het
Thap12	T	C	7: 98,365,947 (GRCm39)	L705P	probably damaging	Het
Tom1	T	C	8: 75,778,218 (GRCm39)	V100A	probably damaging	Het
Tox3	A	G	8: 90,975,057 (GRCm39)		probably benign	Het
Vmn2r82	A	G	10: 79,232,344 (GRCm39)	N781S	probably damaging	Het
Vwa5b1	A	T	4: 138,327,547 (GRCm39)	V343E	possibly damaging	Het
Zbbx	A	G	3: 74,979,047 (GRCm39)	Y467H	probably damaging	Het
Zbtb46	G	A	2: 181,065,632 (GRCm39)	R173W	probably damaging	Het
Zfp112	A	G	7: 23,821,720 (GRCm39)	D20G	probably benign	Het
Zfp777	A	C	6: 48,018,995 (GRCm39)	M313R	probably damaging	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62,283,354 (GRCm39)	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62,216,312 (GRCm39)	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62,231,420 (GRCm39)	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62,231,300 (GRCm39)	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62,225,410 (GRCm39)	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62,240,173 (GRCm39)	intron	probably benign
IGL01889:Ncor1	APN	11	62,225,427 (GRCm39)	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62,235,463 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62,310,435 (GRCm39)	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62,249,743 (GRCm39)	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62,220,485 (GRCm39)	unclassified	probably benign
IGL02288:Ncor1	APN	11	62,240,229 (GRCm39)	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62,224,485 (GRCm39)	splice site	probably benign
IGL02608:Ncor1	APN	11	62,264,040 (GRCm39)	missense	probably benign	0.07
laggard	UTSW	11	62,260,130 (GRCm39)	missense	probably damaging	1.00
Shortstep	UTSW	11	62,225,367 (GRCm39)	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62,419,782 (GRCm38)	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62,235,489 (GRCm39)	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62,224,543 (GRCm39)	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62,329,255 (GRCm39)	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62,233,871 (GRCm39)	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62,233,871 (GRCm39)	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62,283,421 (GRCm39)	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62,301,746 (GRCm39)	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62,264,148 (GRCm39)	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62,224,603 (GRCm39)	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62,224,602 (GRCm39)	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62,234,056 (GRCm39)	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62,224,866 (GRCm39)	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62,294,632 (GRCm39)	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62,225,457 (GRCm39)	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62,269,330 (GRCm39)	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62,313,831 (GRCm39)	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62,275,610 (GRCm39)	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62,217,938 (GRCm39)	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62,272,245 (GRCm39)	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62,228,984 (GRCm39)	missense	probably damaging	1.00
R2009:Ncor1	UTSW	11	62,216,427 (GRCm39)	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62,235,513 (GRCm39)	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62,264,183 (GRCm39)	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62,216,442 (GRCm39)	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62,235,583 (GRCm39)	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62,220,494 (GRCm39)	splice site	probably null
R4350:Ncor1	UTSW	11	62,301,644 (GRCm39)	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62,301,644 (GRCm39)	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62,249,736 (GRCm39)	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62,235,660 (GRCm39)	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62,269,438 (GRCm39)	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62,283,464 (GRCm39)	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62,324,437 (GRCm39)	small deletion	probably benign
R4956:Ncor1	UTSW	11	62,231,431 (GRCm39)	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62,234,167 (GRCm39)	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62,236,063 (GRCm39)	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62,240,290 (GRCm39)	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62,229,826 (GRCm39)	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62,229,788 (GRCm39)	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62,231,371 (GRCm39)	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62,283,475 (GRCm39)	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62,233,837 (GRCm39)	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62,280,604 (GRCm39)	nonsense	probably null
R5593:Ncor1	UTSW	11	62,260,130 (GRCm39)	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62,249,679 (GRCm39)	splice site	probably null
R5632:Ncor1	UTSW	11	62,229,060 (GRCm39)	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62,235,589 (GRCm39)	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62,274,016 (GRCm39)	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62,240,136 (GRCm39)	splice site	probably null
R6013:Ncor1	UTSW	11	62,211,903 (GRCm39)	missense	probably benign
R6019:Ncor1	UTSW	11	62,263,987 (GRCm39)	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62,264,147 (GRCm39)	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62,264,147 (GRCm39)	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62,208,675 (GRCm39)	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62,310,443 (GRCm39)	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62,257,808 (GRCm39)	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62,264,371 (GRCm39)	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62,264,124 (GRCm39)	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62,234,128 (GRCm39)	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62,272,240 (GRCm39)	nonsense	probably null
R6614:Ncor1	UTSW	11	62,221,645 (GRCm39)	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62,225,367 (GRCm39)	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62,264,272 (GRCm39)	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62,234,071 (GRCm39)	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62,220,312 (GRCm39)	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62,244,059 (GRCm39)	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62,275,619 (GRCm39)	missense	probably null
R7248:Ncor1	UTSW	11	62,275,598 (GRCm39)	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62,224,737 (GRCm39)	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62,234,044 (GRCm39)	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62,274,025 (GRCm39)	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62,264,250 (GRCm39)	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62,292,091 (GRCm39)	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62,274,082 (GRCm39)	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62,208,794 (GRCm39)	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62,289,154 (GRCm39)	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62,224,752 (GRCm39)	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62,225,359 (GRCm39)	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62,240,321 (GRCm39)	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62,224,681 (GRCm39)	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62,274,070 (GRCm39)	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62,324,437 (GRCm39)	small deletion	probably benign
R8728:Ncor1	UTSW	11	62,221,685 (GRCm39)	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62,324,494 (GRCm39)	missense	probably damaging	1.00
R8777:Ncor1	UTSW	11	62,324,492 (GRCm39)	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62,324,494 (GRCm39)	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62,324,492 (GRCm39)	missense	probably benign	0.03
R8821:Ncor1	UTSW	11	62,260,234 (GRCm39)	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62,260,234 (GRCm39)	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62,233,871 (GRCm39)	nonsense	probably null
R9111:Ncor1	UTSW	11	62,280,585 (GRCm39)	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62,224,672 (GRCm39)	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62,216,376 (GRCm39)	nonsense	probably null
R9467:Ncor1	UTSW	11	62,324,448 (GRCm39)	small insertion	probably benign
R9467:Ncor1	UTSW	11	62,324,437 (GRCm39)	small insertion	probably benign
R9510:Ncor1	UTSW	11	62,324,442 (GRCm39)	small insertion	probably benign
R9511:Ncor1	UTSW	11	62,324,449 (GRCm39)	small insertion	probably benign
R9560:Ncor1	UTSW	11	62,263,948 (GRCm39)	missense	possibly damaging	0.96
R9687:Ncor1	UTSW	11	62,260,193 (GRCm39)	missense	possibly damaging	0.93
X0065:Ncor1	UTSW	11	62,249,817 (GRCm39)	missense	probably benign	0.23
X0065:Ncor1	UTSW	11	62,245,395 (GRCm39)	critical splice donor site	probably null
Z1176:Ncor1	UTSW	11	62,329,342 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGAGCCATACAGTGATATGACG -3'
(R):5'- GGGCGCTGTCTACACAAATATG -3'

Sequencing Primer
(F):5'- ATGCCAGTGATTAAGCCC -3'
(R):5'- TGACCTATTTAGACCAGGCTAGC -3'

Posted On

2014-07-14