Incidental Mutation 'R2034:Hectd1'
ID224367
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 040041-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2034 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 51757116 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably null
Transcript: ENSMUST00000042052
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179265
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218626
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,559 I65V probably benign Het
Abca13 A G 11: 9,292,628 N1497S possibly damaging Het
Afmid C A 11: 117,835,235 N184K probably benign Het
Ampd2 A T 3: 108,077,363 I459N possibly damaging Het
Anapc1 T C 2: 128,648,458 D1018G possibly damaging Het
Ano9 T A 7: 141,108,135 I223F probably damaging Het
B3gnt6 A G 7: 98,194,018 L245P possibly damaging Het
Bag6 G A 17: 35,144,692 R784Q probably damaging Het
Brca1 C G 11: 101,489,849 S1786T probably benign Het
Btbd3 T G 2: 138,278,983 S26A probably benign Het
Cacna1d C A 14: 30,089,863 V1277L probably damaging Het
Casp12 C T 9: 5,346,491 T6I probably damaging Het
Col7a1 T C 9: 108,963,007 V1262A unknown Het
Crh C A 3: 19,694,098 G127C probably damaging Het
D5Ertd579e A T 5: 36,613,538 L64* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddc T A 11: 11,880,456 I63L probably benign Het
Eif3a C T 19: 60,762,130 probably benign Het
Fsip2 T A 2: 82,989,494 N5190K probably benign Het
Gm5420 A G 10: 21,691,613 noncoding transcript Het
Grb14 A G 2: 64,923,529 probably benign Het
Gsap A T 5: 21,270,595 I545F probably damaging Het
Helz2 G A 2: 181,232,578 P2041L probably damaging Het
Herc1 G A 9: 66,441,972 A2038T probably benign Het
Il10 C A 1: 131,024,185 Q152K probably benign Het
Klrg1 A G 6: 122,279,637 probably null Het
Lrig2 T C 3: 104,494,092 T160A probably benign Het
Mmd2 A T 5: 142,575,184 probably null Het
Mmp2 C T 8: 92,836,912 S338F probably damaging Het
Nalcn T G 14: 123,283,603 D1630A probably benign Het
Ncoa2 T C 1: 13,164,983 S909G probably benign Het
Neb A T 2: 52,280,611 M1683K possibly damaging Het
Nfe2l3 A G 6: 51,458,370 I637V possibly damaging Het
Npw G A 17: 24,658,268 S53F probably damaging Het
Nrbf2 A T 10: 67,275,564 probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nup188 T A 2: 30,310,085 probably benign Het
Olfr1444 T A 19: 12,861,787 M4K possibly damaging Het
Olfr726 T C 14: 50,083,983 M233V probably benign Het
Parp4 A T 14: 56,634,263 I1133F probably damaging Het
Pcdhb11 T C 18: 37,422,493 V292A probably benign Het
Pcnx2 A G 8: 125,818,667 probably null Het
Phf2 A G 13: 48,817,730 S489P unknown Het
Pik3r5 T A 11: 68,493,577 N598K probably damaging Het
Pikfyve A T 1: 65,222,357 E432D probably damaging Het
Pink1 T C 4: 138,318,032 I274V possibly damaging Het
Pkhd1 G A 1: 20,200,669 T3220I probably damaging Het
Plxna2 A G 1: 194,780,594 I890V probably benign Het
Pomgnt1 T C 4: 116,157,927 V492A possibly damaging Het
Prp2 G T 6: 132,595,984 probably null Het
Rabl6 T C 2: 25,585,432 E543G possibly damaging Het
Rgp1 T A 4: 43,581,605 probably null Het
Rps6kb2 T C 19: 4,161,107 T140A probably damaging Het
S100a11 T C 3: 93,526,122 I91T probably benign Het
Serpine2 A G 1: 79,796,852 L230P probably damaging Het
Sh3tc2 A G 18: 61,987,666 D370G probably damaging Het
Sim2 A C 16: 94,085,942 I43L probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc14a2 A G 18: 78,183,583 L419P probably damaging Het
Srgap1 C T 10: 121,792,746 E817K probably damaging Het
Stag3 A G 5: 138,298,001 E442G possibly damaging Het
Sulf1 A G 1: 12,820,421 N361S probably damaging Het
Tmco6 A G 18: 36,737,856 probably null Het
Tmem104 T A 11: 115,243,547 I303N probably benign Het
Ttll6 G T 11: 96,135,526 D86Y probably damaging Het
Vmn1r120 T G 7: 21,052,958 E276A possibly damaging Het
Vmn1r64 A G 7: 5,883,989 M185T probably benign Het
Vmn2r85 A T 10: 130,426,373 probably benign Het
Vwa3a A T 7: 120,782,645 K568* probably null Het
Zcchc11 C T 4: 108,512,195 R651W probably damaging Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51744805 synonymous probably null
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7925:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R8059:Hectd1 UTSW 12 51790378 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGAAAGTGTAAGTGAGCCC -3'
(R):5'- AGCAATGGTTGTTACAAAGAGC -3'

Sequencing Primer
(F):5'- GTGTAAGTGAGCCCCCTCTTAAAG -3'
(R):5'- GCAAGGATTGGAGATATCTCAGTG -3'
Posted On2014-08-25