Mutagenetix > Incidental Mutation

Incidental Mutation 'R2128:Abca6'

227757

Institutional Source

Beutler Lab

Gene Symbol

Abca6

Ensembl Gene

ENSMUSG00000044749

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 6

Synonyms

6330565N06Rik

MMRRC Submission

040131-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2128 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110176820-110251776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110219649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 558 (I558T)

Ref Sequence

ENSEMBL: ENSMUSP00000035458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044003]

AlphaFold

Q8K441

Predicted Effect

probably benign
Transcript: ENSMUST00000044003
AA Change: I558T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: I558T

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	416	1.4e-42	PFAM
low complexity region	484	495	N/A	INTRINSIC
AAA	506	691	1.13e-6	SMART
transmembrane domain	854	876	N/A	INTRINSIC
transmembrane domain	971	990	N/A	INTRINSIC
transmembrane domain	1005	1027	N/A	INTRINSIC
Blast:AAA	1041	1176	4e-21	BLAST
transmembrane domain	1191	1213	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
AAA	1312	1505	2.43e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Acot10	T	C	15: 20,666,626	T10A	probably benign	Het
Adgrl4	T	A	3: 151,500,201	D233E	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Akap2	A	G	4: 57,854,890	Y134C	probably benign	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Arap1	T	A	7: 101,409,320	L1375H	probably damaging	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
Atp13a3	G	A	16: 30,354,276	A261V	probably damaging	Het
Casp8ap2	T	C	4: 32,640,142	Y399H	probably benign	Het
Cept1	A	G	3: 106,512,879	V213A	probably damaging	Het
Cit	A	G	5: 115,985,507	D1469G	possibly damaging	Het
Cnga2	A	G	X: 72,007,788	Y182C	possibly damaging	Het
Cox20	A	G	1: 178,321,947	I54V	probably benign	Het
Dhx8	C	A	11: 101,738,409	D261E	probably benign	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Drd1	T	C	13: 54,053,553	Y207C	probably damaging	Het
Dtl	C	T	1: 191,558,110	V222I	probably damaging	Het
Dync1h1	T	C	12: 110,640,882	Y2636H	probably damaging	Het
Endog	C	A	2: 30,172,036	D154E	probably benign	Het
Epc1	A	T	18: 6,462,954	V14E	probably damaging	Het
Ercc4	C	A	16: 13,147,934	T810K	probably damaging	Het
Fam43b	T	A	4: 138,395,988	N7I	possibly damaging	Het
Fgd1	T	C	X: 151,086,217		probably null	Het
Filip1	G	T	9: 79,819,330	T669N	probably damaging	Het
Fndc1	A	G	17: 7,778,665		probably benign	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Gatm	T	C	2: 122,600,536	N274S	probably damaging	Het
Gdf9	A	G	11: 53,437,507	Y430C	probably damaging	Het
Gga1	C	T	15: 78,888,448	P260S	probably damaging	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm382	G	T	X: 127,062,651	V820L	possibly damaging	Het
Gzmk	T	A	13: 113,172,014	I179F	probably damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Hus1	A	G	11: 9,006,011	M174T	probably damaging	Het
Ifngr2	T	A	16: 91,562,873	Y289*	probably null	Het
Il6st	T	A	13: 112,504,175	H828Q	probably benign	Het
Impg2	T	A	16: 56,218,379	Y127N	probably damaging	Het
Irf3	T	A	7: 45,001,744	W345R	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl42	A	G	6: 147,101,753	T342A	probably benign	Het
Kndc1	G	T	7: 139,930,112	R1289L	probably damaging	Het
Knl1	A	T	2: 119,071,819	T1334S	possibly damaging	Het
L3mbtl3	G	T	10: 26,313,868	D499E	unknown	Het
Ldhd	T	A	8: 111,627,048	M478L	probably benign	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	T	A	4: 123,492,774	I1017F	probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mamdc4	T	C	2: 25,569,258	D195G	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Mycbp2	T	C	14: 103,201,230	M2072V	probably benign	Het
Nck1	A	G	9: 100,497,547		probably null	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Nek11	A	T	9: 105,300,361	D230E	probably benign	Het
Nit2	T	C	16: 57,161,196	K67E	possibly damaging	Het
Olfr2	T	C	7: 107,001,248	D204G	probably damaging	Het
Olfr290	T	C	7: 84,916,493	F238S	probably damaging	Het
Olfr527	C	T	7: 140,336,429	T189M	probably damaging	Het
Olfr802	A	T	10: 129,682,532	V69E	possibly damaging	Het
Pccb	G	C	9: 100,985,831	D347E	probably damaging	Het
Plcl1	T	A	1: 55,697,838	F779L	probably damaging	Het
Prune2	C	A	19: 17,122,422	D1763E	probably benign	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rabgap1l	A	T	1: 160,738,957	D90E	probably benign	Het
Rapgef4	T	A	2: 72,226,553	I552N	possibly damaging	Het
Scn7a	A	T	2: 66,697,986	I720K	probably damaging	Het
Scn9a	T	A	2: 66,526,654	N1101I	probably damaging	Het
Siglec1	A	T	2: 131,080,497	Y553N	probably damaging	Het
Slc22a23	A	G	13: 34,203,970	L381P	possibly damaging	Het
Slc7a11	T	A	3: 50,384,109	T284S	probably damaging	Het
Slc8a2	T	A	7: 16,140,492		probably null	Het
Snx29	T	A	16: 11,400,971	S224T	probably damaging	Het
Stox1	T	C	10: 62,664,535	T749A	probably benign	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem110	T	C	14: 30,866,624	Y103H	probably damaging	Het
Top2a	A	C	11: 99,009,807	V609G	probably damaging	Het
Trmt44	G	A	5: 35,574,832	P72S	probably benign	Het
Ttll3	G	C	6: 113,412,934	S760T	probably benign	Het
Ttn	T	C	2: 76,748,678	D23957G	probably damaging	Het
Ttn	G	A	2: 76,833,897		probably benign	Het
Ubxn1	T	G	19: 8,872,070	V59G	probably benign	Het
Ubxn4	T	C	1: 128,244,510	S14P	probably benign	Het
Uso1	T	A	5: 92,195,370	M771K	probably benign	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Vmn2r19	A	G	6: 123,308,330		probably null	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zbtb26	G	T	2: 37,436,551	Q158K	probably benign	Het
Zfp648	T	C	1: 154,204,607	S171P	probably benign	Het

Other mutations in Abca6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca6	APN	11	110184709	missense	probably damaging	1.00
IGL00569:Abca6	APN	11	110187049	missense	possibly damaging	0.88
IGL00737:Abca6	APN	11	110196997	splice site	probably benign
IGL01024:Abca6	APN	11	110197142	missense	probably benign
IGL01087:Abca6	APN	11	110191650	missense	probably benign	0.00
IGL01511:Abca6	APN	11	110244310	missense	probably benign	0.00
IGL01516:Abca6	APN	11	110218217	missense	possibly damaging	0.70
IGL01621:Abca6	APN	11	110184708	missense	probably damaging	1.00
IGL01749:Abca6	APN	11	110244224	missense	probably damaging	1.00
IGL01934:Abca6	APN	11	110188655	missense	probably benign	0.00
IGL02010:Abca6	APN	11	110219616	missense	probably benign	0.12
IGL02121:Abca6	APN	11	110182924	missense	probably benign	0.38
IGL02423:Abca6	APN	11	110219006	splice site	probably benign
IGL02428:Abca6	APN	11	110178792	missense	possibly damaging	0.81
IGL02491:Abca6	APN	11	110176968	utr 3 prime	probably benign
IGL02541:Abca6	APN	11	110212267	missense	probably damaging	1.00
IGL02792:Abca6	APN	11	110188681	missense	probably damaging	0.99
IGL02836:Abca6	APN	11	110248548	missense	probably damaging	1.00
IGL02965:Abca6	APN	11	110180613	missense	probably benign
IGL03094:Abca6	APN	11	110184112	missense	probably benign	0.03
IGL03109:Abca6	APN	11	110180347	missense	probably damaging	0.96
R0068:Abca6	UTSW	11	110182882	missense	probably damaging	1.00
R0142:Abca6	UTSW	11	110188641	missense	probably damaging	1.00
R0165:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R0254:Abca6	UTSW	11	110236789	missense	probably benign	0.16
R0598:Abca6	UTSW	11	110197154	missense	probably damaging	1.00
R0992:Abca6	UTSW	11	110211684	missense	probably damaging	1.00
R1386:Abca6	UTSW	11	110244255	missense	probably benign	0.02
R1642:Abca6	UTSW	11	110218281	missense	possibly damaging	0.73
R1673:Abca6	UTSW	11	110212339	missense	probably benign	0.01
R1792:Abca6	UTSW	11	110184044	missense	probably benign	0.00
R1813:Abca6	UTSW	11	110233845	splice site	probably benign
R1817:Abca6	UTSW	11	110219318	missense	probably benign	0.00
R1842:Abca6	UTSW	11	110197039	missense	probably benign	0.00
R1898:Abca6	UTSW	11	110208799	missense	probably damaging	0.99
R1914:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1915:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1934:Abca6	UTSW	11	110210083	critical splice donor site	probably null
R1964:Abca6	UTSW	11	110184676	missense	probably damaging	0.98
R1967:Abca6	UTSW	11	110187148	missense	probably benign	0.09
R2127:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2164:Abca6	UTSW	11	110210193	frame shift	probably null
R2895:Abca6	UTSW	11	110202426	missense	probably benign	0.00
R3110:Abca6	UTSW	11	110178829	nonsense	probably null
R3111:Abca6	UTSW	11	110178829	nonsense	probably null
R3112:Abca6	UTSW	11	110178829	nonsense	probably null
R4094:Abca6	UTSW	11	110180366	missense	probably damaging	1.00
R4432:Abca6	UTSW	11	110241588	missense	probably benign	0.11
R4474:Abca6	UTSW	11	110233772	missense	possibly damaging	0.46
R4572:Abca6	UTSW	11	110216548	missense	probably benign	0.31
R4629:Abca6	UTSW	11	110230549	critical splice acceptor site	probably null
R4793:Abca6	UTSW	11	110191718	missense	probably benign
R4852:Abca6	UTSW	11	110244203	missense	probably benign	0.09
R4867:Abca6	UTSW	11	110202379	missense	probably benign	0.01
R4879:Abca6	UTSW	11	110219700	missense	probably damaging	0.98
R4918:Abca6	UTSW	11	110180551	missense	probably damaging	1.00
R5060:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R5062:Abca6	UTSW	11	110177066	missense	probably benign	0.12
R5083:Abca6	UTSW	11	110218967	missense	probably damaging	1.00
R5173:Abca6	UTSW	11	110191720	missense	probably benign
R5393:Abca6	UTSW	11	110244295	missense	probably benign	0.00
R5484:Abca6	UTSW	11	110184073	missense	probably damaging	1.00
R5498:Abca6	UTSW	11	110208844	missense	possibly damaging	0.95
R5503:Abca6	UTSW	11	110218257	missense	probably damaging	1.00
R5645:Abca6	UTSW	11	110250408	missense	probably damaging	0.99
R5680:Abca6	UTSW	11	110236645	missense	possibly damaging	0.88
R5761:Abca6	UTSW	11	110210101	missense	probably damaging	1.00
R5779:Abca6	UTSW	11	110184670	missense	probably benign	0.37
R5818:Abca6	UTSW	11	110219643	missense	probably damaging	1.00
R6282:Abca6	UTSW	11	110208824	missense	probably damaging	0.98
R6455:Abca6	UTSW	11	110241581	missense	probably damaging	1.00
R6826:Abca6	UTSW	11	110216605	missense	probably benign	0.15
R6857:Abca6	UTSW	11	110219688	missense	possibly damaging	0.63
R6914:Abca6	UTSW	11	110190238	missense	probably benign
R6931:Abca6	UTSW	11	110244328	missense	probably benign	0.27
R7222:Abca6	UTSW	11	110191693	missense	probably benign	0.29
R7242:Abca6	UTSW	11	110241653	missense	possibly damaging	0.47
R7297:Abca6	UTSW	11	110183026	critical splice donor site	probably null
R7387:Abca6	UTSW	11	110202420	missense	probably benign
R7420:Abca6	UTSW	11	110250477	missense	probably benign	0.24
R7494:Abca6	UTSW	11	110208745	missense	possibly damaging	0.93
R7603:Abca6	UTSW	11	110180258	missense	possibly damaging	0.69
R7637:Abca6	UTSW	11	110218952	missense	probably benign	0.00
R7674:Abca6	UTSW	11	110219297	missense	probably damaging	1.00
R7753:Abca6	UTSW	11	110184107	missense	probably damaging	1.00
R7800:Abca6	UTSW	11	110187872	missense	probably benign	0.00
R7842:Abca6	UTSW	11	110196697	missense	possibly damaging	0.76
R7855:Abca6	UTSW	11	110191628	missense	probably benign	0.01
R8119:Abca6	UTSW	11	110197104	missense	probably benign	0.00
R8139:Abca6	UTSW	11	110184133	missense	probably damaging	1.00
R8176:Abca6	UTSW	11	110244194	missense	probably benign	0.01
R8179:Abca6	UTSW	11	110245274	missense	probably damaging	1.00
R8197:Abca6	UTSW	11	110211815	missense	probably damaging	0.99
R8241:Abca6	UTSW	11	110188630	missense	probably null	1.00
R8404:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8429:Abca6	UTSW	11	110202382	missense	probably benign
R8502:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8816:Abca6	UTSW	11	110236687	missense	probably benign	0.04
R8964:Abca6	UTSW	11	110248537	missense	probably benign	0.00
R9153:Abca6	UTSW	11	110216655	missense	possibly damaging	0.61
R9233:Abca6	UTSW	11	110191670	missense	probably benign	0.31
R9407:Abca6	UTSW	11	110202384	nonsense	probably null
R9412:Abca6	UTSW	11	110212233	missense	probably damaging	0.99
R9453:Abca6	UTSW	11	110247264	critical splice donor site	probably null
R9533:Abca6	UTSW	11	110211756	missense	probably benign	0.16
R9546:Abca6	UTSW	11	110244216	nonsense	probably null
R9650:Abca6	UTSW	11	110180620	missense	probably benign	0.32
R9702:Abca6	UTSW	11	110216552	missense	probably damaging	1.00
R9709:Abca6	UTSW	11	110211763	missense	probably benign	0.01
X0024:Abca6	UTSW	11	110244255	missense	probably benign	0.02
X0064:Abca6	UTSW	11	110197142	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGAGGTCATGATTGAACATGG -3'
(R):5'- CTCAGAGAGAACGTGCTACACAG -3'

Sequencing Primer
(F):5'- CATGATTGAACATGGTTAATGATGGG -3'
(R):5'- GTGCTACACAGTATCTACACTAGG -3'

Posted On

2014-09-17