Incidental Mutation 'R2269:Abca16'
ID242317
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission 040269-MU
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2269 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120431160 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 165 (D165G)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: D165G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D165G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: D165G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D165G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCACTGTGCATTCTAGG -3'
(R):5'- ATAAAGACTCTCCTGTGCTTGC -3'

Sequencing Primer
(F):5'- ACTGTGCATTCTAGGCATTCAG -3'
(R):5'- TCCTGTGCTTGCCCTGGAG -3'
Posted On2014-10-16