Incidental Mutation 'R3765:Fuk'
ID 274653
Institutional Source Beutler Lab
Gene Symbol Fuk
Ensembl Gene ENSMUSG00000033703
Gene Name fucokinase
Synonyms L-fucose kinase, 1110046B12Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R3765 (G1)
Quality Score 223
Status Not validated
Chromosome 8
Chromosomal Location 110882456-110902488 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110887104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 775 (I775T)
Ref Sequence ENSEMBL: ENSMUSP00000039271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000041382] [ENSMUST00000174679] [ENSMUST00000212971]
AlphaFold Q7TMC8
Predicted Effect probably benign
Transcript: ENSMUST00000034203
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041382
AA Change: I775T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: I775T

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Predicted Effect probably benign
Transcript: ENSMUST00000212971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Fuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Fuk APN 8 110890476 missense possibly damaging 0.75
IGL01963:Fuk APN 8 110893402 missense probably damaging 1.00
IGL01986:Fuk APN 8 110883257 missense probably benign
PIT4283001:Fuk UTSW 8 110887432 missense probably benign 0.05
R0008:Fuk UTSW 8 110884233 splice site probably benign
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0280:Fuk UTSW 8 110894748 missense probably damaging 1.00
R0285:Fuk UTSW 8 110893717 missense probably benign 0.08
R0359:Fuk UTSW 8 110893259 splice site probably null
R0587:Fuk UTSW 8 110883325 missense probably damaging 0.98
R1528:Fuk UTSW 8 110883241 missense probably damaging 1.00
R1731:Fuk UTSW 8 110894823 missense probably damaging 0.96
R1907:Fuk UTSW 8 110893378 nonsense probably null
R2152:Fuk UTSW 8 110889072 missense probably benign 0.03
R2154:Fuk UTSW 8 110889072 missense probably benign 0.03
R2392:Fuk UTSW 8 110889724 missense probably benign
R3037:Fuk UTSW 8 110894718 splice site probably null
R3714:Fuk UTSW 8 110887259 missense probably damaging 1.00
R4307:Fuk UTSW 8 110892080 nonsense probably null
R4404:Fuk UTSW 8 110890301 missense probably benign 0.03
R4768:Fuk UTSW 8 110892134 missense probably benign 0.00
R4998:Fuk UTSW 8 110887803 missense probably damaging 0.96
R5009:Fuk UTSW 8 110887830 missense probably damaging 0.99
R5253:Fuk UTSW 8 110883867 missense possibly damaging 0.90
R6257:Fuk UTSW 8 110890545 missense probably benign 0.00
R6430:Fuk UTSW 8 110884116 missense probably benign 0.16
R6536:Fuk UTSW 8 110883879 missense possibly damaging 0.47
R6599:Fuk UTSW 8 110893283 splice site probably null
R6799:Fuk UTSW 8 110893418 missense probably benign
R7051:Fuk UTSW 8 110890339 missense probably damaging 0.97
R7184:Fuk UTSW 8 110887156 missense probably damaging 1.00
R7241:Fuk UTSW 8 110895897 missense probably benign
R7448:Fuk UTSW 8 110890331 missense possibly damaging 0.93
R8081:Fuk UTSW 8 110889151 missense probably benign
R8094:Fuk UTSW 8 110895972 missense probably damaging 1.00
R8692:Fuk UTSW 8 110889090 missense probably benign 0.06
R9036:Fuk UTSW 8 110887432 missense probably benign 0.05
R9172:Fuk UTSW 8 110883925 missense probably damaging 1.00
R9471:Fuk UTSW 8 110883409 missense probably benign 0.01
R9580:Fuk UTSW 8 110890181 missense probably damaging 0.99
R9733:Fuk UTSW 8 110888931 missense probably benign 0.01
R9780:Fuk UTSW 8 110887111 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAAGGGTAACTGTCAGCC -3'
(R):5'- TTGTTGAACTGCACTAGGGG -3'

Sequencing Primer
(F):5'- AGAAGGGTAACTGTCAGCCTTTTC -3'
(R):5'- AACTGCACTAGGGGGCTGG -3'
Posted On 2015-04-02