Incidental Mutation 'R3107:Dnah7b'
ID 263608
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms Dnahc7b, LOC227058
MMRRC Submission 040581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R3107 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 46066315-46373546 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46352873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 3798 (G3798E)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069293
AA Change: G3798E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: G3798E

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185879
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 (GRCm38) L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 (GRCm38) Y528* probably null Het
Ankrd26 A T 6: 118,556,243 (GRCm38) F198L probably benign Het
Arnt2 A G 7: 84,262,444 (GRCm38) S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 (GRCm38) V269A probably benign Het
Cers1 T A 8: 70,322,636 (GRCm38) H233Q probably benign Het
Cfap54 T C 10: 92,994,683 (GRCm38) N1197S probably benign Het
Cfb A G 17: 34,861,824 (GRCm38) Y66H possibly damaging Het
Clspn A G 4: 126,591,659 (GRCm38) D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 (GRCm38) C373R probably damaging Het
Col19a1 T C 1: 24,337,936 (GRCm38) T443A possibly damaging Het
Cubn T C 2: 13,362,347 (GRCm38) S1571G possibly damaging Het
Ddt C T 10: 75,772,763 (GRCm38) E42K probably benign Het
Dmrt2 C A 19: 25,677,691 (GRCm38) T218N probably benign Het
Espl1 A G 15: 102,312,989 (GRCm38) I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 (GRCm38) K317N probably benign Het
Fyn G C 10: 39,551,455 (GRCm38) D445H probably damaging Het
Gprasp1 A T X: 135,799,759 (GRCm38) M234L probably benign Het
Ibtk T C 9: 85,710,414 (GRCm38) Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 (GRCm38) V33A probably damaging Het
Ints6 T C 14: 62,760,592 (GRCm38) T23A possibly damaging Het
Itk C A 11: 46,327,464 (GRCm38) G624V probably benign Het
Lama2 C T 10: 27,001,235 (GRCm38) E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 (GRCm38) I109F probably damaging Het
Mov10 T C 3: 104,799,724 (GRCm38) E653G probably damaging Het
Olfr916 C T 9: 38,658,011 (GRCm38) C127Y possibly damaging Het
Plg T C 17: 12,384,429 (GRCm38) V74A probably benign Het
Ptprn2 A G 12: 116,876,180 (GRCm38) D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 (GRCm38) G303E probably damaging Het
Satb1 A T 17: 51,782,782 (GRCm38) Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 (GRCm38) I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 (GRCm38) Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 (GRCm38) probably null Het
Sorcs1 T C 19: 50,210,650 (GRCm38) E825G possibly damaging Het
Sval1 C G 6: 41,955,942 (GRCm38) P145A probably damaging Het
Trhde C T 10: 114,592,066 (GRCm38) E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 (GRCm38) D368V possibly damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,142,149 (GRCm38) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,211,337 (GRCm38) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,224,651 (GRCm38) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,066,729 (GRCm38) unclassified probably benign
IGL00950:Dnah7b APN 1 46,214,322 (GRCm38) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,195,378 (GRCm38) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,081,432 (GRCm38) splice site probably benign
IGL01392:Dnah7b APN 1 46,126,788 (GRCm38) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,116,300 (GRCm38) splice site probably benign
IGL01460:Dnah7b APN 1 46,139,704 (GRCm38) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,268,653 (GRCm38) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,358,147 (GRCm38) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,358,137 (GRCm38) nonsense probably null
IGL01906:Dnah7b APN 1 46,175,453 (GRCm38) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,124,337 (GRCm38) splice site probably benign
IGL01989:Dnah7b APN 1 46,289,534 (GRCm38) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,139,875 (GRCm38) missense probably benign
IGL02213:Dnah7b APN 1 46,233,592 (GRCm38) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,226,930 (GRCm38) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,099,503 (GRCm38) nonsense probably null
IGL02381:Dnah7b APN 1 46,277,120 (GRCm38) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,234,193 (GRCm38) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,195,318 (GRCm38) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,123,777 (GRCm38) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,116,301 (GRCm38) splice site probably benign
IGL02704:Dnah7b APN 1 46,142,133 (GRCm38) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,099,608 (GRCm38) splice site probably benign
IGL02745:Dnah7b APN 1 46,195,029 (GRCm38) splice site probably benign
IGL02818:Dnah7b APN 1 46,290,808 (GRCm38) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,119,298 (GRCm38) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,182,375 (GRCm38) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,085,689 (GRCm38) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,119,304 (GRCm38) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,373,348 (GRCm38) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,213,360 (GRCm38) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,223,178 (GRCm38) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,219,348 (GRCm38) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,123,777 (GRCm38) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,207,643 (GRCm38) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,134,656 (GRCm38) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,240,944 (GRCm38) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,277,126 (GRCm38) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,236,788 (GRCm38) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,140,176 (GRCm38) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,219,544 (GRCm38) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,324,842 (GRCm38) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,240,992 (GRCm38) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,324,842 (GRCm38) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,340,132 (GRCm38) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,099,612 (GRCm38) splice site probably benign
R1035:Dnah7b UTSW 1 46,124,448 (GRCm38) missense probably benign
R1147:Dnah7b UTSW 1 46,340,266 (GRCm38) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,340,266 (GRCm38) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,325,810 (GRCm38) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,340,120 (GRCm38) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,099,509 (GRCm38) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,322,335 (GRCm38) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,289,656 (GRCm38) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,078,593 (GRCm38) splice site probably benign
R1484:Dnah7b UTSW 1 46,137,543 (GRCm38) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,177,281 (GRCm38) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,066,797 (GRCm38) missense unknown
R1607:Dnah7b UTSW 1 46,290,646 (GRCm38) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,352,966 (GRCm38) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,175,390 (GRCm38) nonsense probably null
R1681:Dnah7b UTSW 1 46,324,712 (GRCm38) nonsense probably null
R1716:Dnah7b UTSW 1 46,191,783 (GRCm38) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,322,335 (GRCm38) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,233,759 (GRCm38) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,277,105 (GRCm38) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,116,177 (GRCm38) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,236,714 (GRCm38) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,242,103 (GRCm38) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,142,087 (GRCm38) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,242,321 (GRCm38) nonsense probably null
R2083:Dnah7b UTSW 1 46,241,067 (GRCm38) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,097,992 (GRCm38) splice site probably benign
R2172:Dnah7b UTSW 1 46,124,512 (GRCm38) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,201,184 (GRCm38) splice site probably benign
R2247:Dnah7b UTSW 1 46,277,063 (GRCm38) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,233,915 (GRCm38) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,362,954 (GRCm38) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,195,287 (GRCm38) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,139,741 (GRCm38) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,207,572 (GRCm38) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,188,687 (GRCm38) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,182,423 (GRCm38) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,268,709 (GRCm38) missense possibly damaging 0.95
R3735:Dnah7b UTSW 1 46,299,875 (GRCm38) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,243,257 (GRCm38) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,137,485 (GRCm38) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,233,711 (GRCm38) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,081,495 (GRCm38) missense probably benign
R4172:Dnah7b UTSW 1 46,226,946 (GRCm38) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,137,418 (GRCm38) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,221,772 (GRCm38) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,337,594 (GRCm38) splice site probably null
R4414:Dnah7b UTSW 1 46,126,680 (GRCm38) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,085,632 (GRCm38) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,289,536 (GRCm38) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,078,524 (GRCm38) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,217,157 (GRCm38) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,211,328 (GRCm38) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,207,656 (GRCm38) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,066,955 (GRCm38) missense unknown
R4780:Dnah7b UTSW 1 46,353,014 (GRCm38) missense probably benign
R4828:Dnah7b UTSW 1 46,128,112 (GRCm38) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,356,602 (GRCm38) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,195,074 (GRCm38) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,081,444 (GRCm38) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,201,318 (GRCm38) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,290,775 (GRCm38) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,233,726 (GRCm38) missense probably benign
R5000:Dnah7b UTSW 1 46,099,503 (GRCm38) nonsense probably null
R5005:Dnah7b UTSW 1 46,242,028 (GRCm38) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,187,363 (GRCm38) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,182,380 (GRCm38) nonsense probably null
R5174:Dnah7b UTSW 1 46,243,349 (GRCm38) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,358,216 (GRCm38) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,233,858 (GRCm38) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,373,354 (GRCm38) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,233,689 (GRCm38) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,217,191 (GRCm38) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,188,659 (GRCm38) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,358,271 (GRCm38) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,242,206 (GRCm38) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,242,019 (GRCm38) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,109,312 (GRCm38) missense probably null
R5479:Dnah7b UTSW 1 46,223,105 (GRCm38) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,242,199 (GRCm38) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,356,514 (GRCm38) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,268,764 (GRCm38) splice site probably null
R5659:Dnah7b UTSW 1 46,352,849 (GRCm38) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,233,992 (GRCm38) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,277,120 (GRCm38) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,142,132 (GRCm38) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,191,725 (GRCm38) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,337,593 (GRCm38) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,221,643 (GRCm38) missense probably benign
R5941:Dnah7b UTSW 1 46,187,290 (GRCm38) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,362,987 (GRCm38) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,119,398 (GRCm38) splice site probably null
R6041:Dnah7b UTSW 1 46,289,645 (GRCm38) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,139,789 (GRCm38) missense probably benign
R6049:Dnah7b UTSW 1 46,085,602 (GRCm38) missense probably benign
R6131:Dnah7b UTSW 1 46,253,466 (GRCm38) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,290,703 (GRCm38) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,204,269 (GRCm38) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,233,585 (GRCm38) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,126,668 (GRCm38) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,204,269 (GRCm38) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,225,888 (GRCm38) missense probably benign
R6273:Dnah7b UTSW 1 46,242,316 (GRCm38) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,325,886 (GRCm38) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,325,886 (GRCm38) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,340,175 (GRCm38) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,242,204 (GRCm38) nonsense probably null
R6494:Dnah7b UTSW 1 46,099,431 (GRCm38) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,224,742 (GRCm38) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,340,217 (GRCm38) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,191,788 (GRCm38) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,195,120 (GRCm38) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,119,268 (GRCm38) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,358,238 (GRCm38) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,195,139 (GRCm38) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,236,809 (GRCm38) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,352,813 (GRCm38) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,139,710 (GRCm38) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,126,804 (GRCm38) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,242,142 (GRCm38) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,139,966 (GRCm38) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,083,754 (GRCm38) missense probably benign
R7244:Dnah7b UTSW 1 46,277,143 (GRCm38) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,142,085 (GRCm38) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,195,372 (GRCm38) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,303,634 (GRCm38) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,175,419 (GRCm38) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,290,734 (GRCm38) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,325,765 (GRCm38) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,356,554 (GRCm38) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,124,346 (GRCm38) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,214,413 (GRCm38) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,268,634 (GRCm38) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,109,302 (GRCm38) missense probably benign
R7676:Dnah7b UTSW 1 46,234,164 (GRCm38) nonsense probably null
R7731:Dnah7b UTSW 1 46,139,745 (GRCm38) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,201,253 (GRCm38) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,137,474 (GRCm38) missense probably benign
R7807:Dnah7b UTSW 1 46,214,367 (GRCm38) missense probably benign
R7895:Dnah7b UTSW 1 46,249,950 (GRCm38) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,139,678 (GRCm38) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,227,003 (GRCm38) missense probably benign
R7946:Dnah7b UTSW 1 46,233,579 (GRCm38) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,243,424 (GRCm38) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,243,365 (GRCm38) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,224,706 (GRCm38) nonsense probably null
R8094:Dnah7b UTSW 1 46,126,804 (GRCm38) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,233,753 (GRCm38) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,253,511 (GRCm38) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,356,576 (GRCm38) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,139,872 (GRCm38) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,175,296 (GRCm38) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,356,659 (GRCm38) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,188,679 (GRCm38) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,290,715 (GRCm38) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,099,490 (GRCm38) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,116,200 (GRCm38) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,175,438 (GRCm38) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,182,464 (GRCm38) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,352,999 (GRCm38) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,123,646 (GRCm38) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,234,145 (GRCm38) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,191,793 (GRCm38) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,241,076 (GRCm38) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,253,374 (GRCm38) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,223,072 (GRCm38) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,243,415 (GRCm38) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,134,514 (GRCm38) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,227,020 (GRCm38) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,142,034 (GRCm38) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,290,878 (GRCm38) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,322,260 (GRCm38) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,233,754 (GRCm38) nonsense probably null
R9392:Dnah7b UTSW 1 46,123,738 (GRCm38) nonsense probably null
R9456:Dnah7b UTSW 1 46,126,793 (GRCm38) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,214,404 (GRCm38) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,225,796 (GRCm38) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,253,461 (GRCm38) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,213,384 (GRCm38) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,337,594 (GRCm38) splice site probably null
RF020:Dnah7b UTSW 1 46,373,261 (GRCm38) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,373,298 (GRCm38) nonsense probably null
X0023:Dnah7b UTSW 1 46,303,577 (GRCm38) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAGTCTGGGCCCAACACTC -3'
(R):5'- GTACTTTCCAGTACCTGAGACTAG -3'

Sequencing Primer
(F):5'- GTCTGGGCCCAACACTCAGTATC -3'
(R):5'- CAGTGTTCATGCTCTGAG -3'
Posted On 2015-02-05