Mutagenetix > Incidental Mutation

Incidental Mutation 'R5849:Abca8b'

453793

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

044066-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5849 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 109977813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 175 (G175V)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably damaging
Transcript: ENSMUST00000020948
AA Change: G175V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: G175V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106669
AA Change: G175V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: G175V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.9202

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,498	D111G	probably benign	Het
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Agbl1	T	C	7: 76,325,098	S113P	probably benign	Het
Ak9	A	G	10: 41,348,049	D486G	probably benign	Het
Arhgap11a	T	C	2: 113,834,847	S469G	probably null	Het
Ccdc144b	A	T	3: 36,032,877	D189E	possibly damaging	Het
Comtd1	C	T	14: 21,848,120	G48D	probably damaging	Het
Cyp27a1	T	C	1: 74,736,684	S343P	probably damaging	Het
Dcun1d1	T	A	3: 35,916,184		probably benign	Het
Dennd4c	T	C	4: 86,825,986	I1404T	possibly damaging	Het
Dlgap5	A	G	14: 47,389,435	S766P	possibly damaging	Het
Ebf1	T	A	11: 44,990,504		probably null	Het
Flcn	T	A	11: 59,804,760	I4L	probably damaging	Het
Grin2c	T	C	11: 115,260,991	T48A	probably benign	Het
Hyal5	T	A	6: 24,891,556	S456R	probably benign	Het
Igf1r	A	G	7: 68,190,033	D696G	probably benign	Het
Iqgap1	A	T	7: 80,803,158	V13D	probably benign	Het
Itgal	A	G	7: 127,317,320	N728S	probably benign	Het
Kcnb1	T	A	2: 167,106,026	I301F	probably damaging	Het
Kcnd3	A	G	3: 105,458,795		probably benign	Het
Kdm4a	C	T	4: 118,161,840	R393Q	probably benign	Het
Lcn9	G	A	2: 25,823,256		probably null	Het
Madcam1	T	A	10: 79,664,990	M47K	probably benign	Het
Matn3	A	G	12: 8,958,829	Q314R	probably benign	Het
Msh3	A	T	13: 92,249,878	D826E	possibly damaging	Het
Muc4	A	T	16: 32,774,839	T3088S	possibly damaging	Het
Mup3	T	G	4: 62,086,935		probably null	Het
Myo15b	A	G	11: 115,881,933	K1807E	probably damaging	Het
Myrip	A	G	9: 120,453,693	D688G	probably damaging	Het
Nup153	A	G	13: 46,686,976	F1052S	probably damaging	Het
Olfr1013	A	T	2: 85,770,424	I208F	probably benign	Het
Olfr1316	A	T	2: 112,129,878	I311K	probably benign	Het
Olfr1336	A	T	7: 6,460,994	I162F	possibly damaging	Het
Olfr584	T	A	7: 103,085,521	M1K	probably null	Het
Oplah	T	A	15: 76,297,347		probably benign	Het
Pacsin2	A	G	15: 83,390,518	F120L	possibly damaging	Het
Ppp1r36	C	A	12: 76,439,157	P363Q	probably damaging	Het
Rai1	C	A	11: 60,190,521	H1804N	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rnf214	G	A	9: 45,868,088	P455S	probably damaging	Het
Rnf220	T	C	4: 117,277,612	T188A	possibly damaging	Het
S1pr4	C	T	10: 81,499,323	V106M	possibly damaging	Het
Sall2	C	A	14: 52,314,247	S495I	probably benign	Het
Sars2	A	G	7: 28,744,258	E95G	possibly damaging	Het
Sema3f	G	A	9: 107,682,616	T693M	probably damaging	Het
Slfn2	C	A	11: 83,069,576	T127K	probably benign	Het
Snrpe	T	A	1: 133,608,914	I43L	probably benign	Het
Srsf1	T	C	11: 88,047,858	I7T	possibly damaging	Het
Ssbp1	T	A	6: 40,476,903		probably benign	Het
Stbd1	T	G	5: 92,604,995	F115V	probably benign	Het
Stk11ip	T	A	1: 75,527,355		probably null	Het
Taf1b	T	A	12: 24,500,525	N36K	probably damaging	Het
Tanc1	A	T	2: 59,799,904	M743L	probably benign	Het
Tnfsf12	C	A	11: 69,686,967	R208L	probably damaging	Het
Trafd1	T	C	5: 121,373,471	D428G	probably damaging	Het
Trim24	A	G	6: 37,957,729	E793G	probably damaging	Het
Tspan32	T	C	7: 143,015,587	C100R	probably damaging	Het
Ttn	T	C	2: 76,746,242	D16442G	probably damaging	Het
Ube3c	T	A	5: 29,658,409	L894Q	probably damaging	Het
Wfs1	C	G	5: 36,973,264	G213R	probably damaging	Het
Zfp384	G	A	6: 125,024,099	A45T	possibly damaging	Het
Zfp865	G	T	7: 5,031,087	K690N	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTGTTTTGTACCATACAGCAGC -3'
(R):5'- GATAATTCAAGGTAGGTGGTTCCC -3'

Sequencing Primer
(F):5'- GTACCATACAGCAGCTTTAGTAAC -3'
(R):5'- TAGGTGGTTCCCTGGGAGACC -3'

Posted On

2017-02-10