Incidental Mutation 'R0396:Cdon'
ID32056
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R0396 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35470130 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 605 (N605K)
Ref Sequence ENSEMBL: ENSMUSP00000117499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000154652]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: N605K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: N605K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084000
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: N605K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: N605K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127264
SMART Domains Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 1 51 6.26e-5 SMART
IG_like 18 62 1.06e2 SMART
IGc2 81 134 6.45e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154652
AA Change: N605K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: N605K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCAGAATGATGAGCGAGACCC -3'
(R):5'- AGCTTGAAACCTTGAGTTCCAGCAC -3'

Sequencing Primer
(F):5'- AGACGGTTCAGAGTCCAGC -3'
(R):5'- ggagggaagaagggggag -3'
Posted On2013-04-24