Mutagenetix > Incidental Mutations

Incidental Mutation 'R4662:Dnajc13'

352936

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

042011-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R4662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 104207758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 819 (F819V)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

probably damaging
Transcript: ENSMUST00000035170
AA Change: F814V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: F814V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186788
AA Change: F819V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: F819V

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188592

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	T	6: 91,914,958	Q67L	probably benign	Het
8030462N17Rik	T	A	18: 77,674,490	Q42L	probably benign	Het
Adrb1	A	G	19: 56,722,774	T135A	probably damaging	Het
Asxl2	G	T	12: 3,427,193	W13L	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Brsk1	T	C	7: 4,707,299	S436P	possibly damaging	Het
Calb2	A	G	8: 110,168,077	F21L	probably benign	Het
Camk2a	T	C	18: 60,941,339	Y39H	probably damaging	Het
Cavin2	T	C	1: 51,301,351	S396P	probably benign	Het
Cfdp1	A	G	8: 111,830,945	F188S	probably benign	Het
Chek2	T	A	5: 110,867,042	V459D	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Cobl	A	G	11: 12,253,672	V1003A	probably benign	Het
Ctsll3	A	G	13: 60,799,602	F257L	possibly damaging	Het
Dram1	C	A	10: 88,325,384	V208L	probably damaging	Het
Dynlt1b	A	G	17: 6,431,880	T10A	probably benign	Het
Eml6	A	T	11: 29,777,390	V1244E	probably damaging	Het
Ethe1	G	A	7: 24,593,980	S17N	probably benign	Het
Foxi1	T	C	11: 34,207,578	D149G	probably damaging	Het
Fzd9	T	C	5: 135,249,621	E470G	probably damaging	Het
Ggnbp2	A	G	11: 84,862,246	F56L	probably damaging	Het
Gm5346	T	A	8: 43,627,079	Y36F	probably benign	Het
Hao1	G	A	2: 134,523,027	R227*	probably null	Het
Hyal1	G	A	9: 107,579,221	R369H	probably damaging	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Kcna2	T	A	3: 107,105,417	I438N	probably benign	Het
Lrp1	A	T	10: 127,552,185	C3331*	probably null	Het
Mcm9	T	C	10: 53,548,527	I656V	probably benign	Het
Mroh9	C	T	1: 163,055,593	C439Y	probably damaging	Het
N4bp2l2	T	C	5: 150,650,695	D85G	probably damaging	Het
Nr1h2	A	G	7: 44,550,431	Y355H	probably damaging	Het
Nr5a2	T	C	1: 136,940,429	I322V	probably benign	Het
Nup153	A	C	13: 46,687,274	L273V	possibly damaging	Het
Obscn	A	G	11: 58,999,596	L7370P	unknown	Het
Olfr1270	T	A	2: 90,149,878	I43F	probably damaging	Het
Olfr178	A	G	16: 58,889,924	C99R	probably damaging	Het
Olfr403	T	C	11: 74,195,716	I71T	probably damaging	Het
Prkdc	G	A	16: 15,734,052	D2041N	probably damaging	Het
Ptdss1	A	G	13: 66,933,611	D35G	possibly damaging	Het
Ptprs	G	T	17: 56,417,666	T1118K	probably damaging	Het
Pygb	C	T	2: 150,815,116	T329I	probably benign	Het
Rhoh	T	A	5: 65,892,814	D142E	probably benign	Het
Saraf	C	A	8: 34,168,462	A306E	probably damaging	Het
Scn1a	T	C	2: 66,350,988	I64V	probably benign	Het
Sec16a	A	G	2: 26,430,570	W1333R	probably damaging	Het
Shroom1	A	T	11: 53,466,462	T651S	possibly damaging	Het
Skint3	C	A	4: 112,277,666	Y345*	probably null	Het
Slc1a7	T	A	4: 108,007,554	N263K	probably damaging	Het
Sptbn2	C	T	19: 4,739,239	R1236C	probably damaging	Het
Tbx21	T	C	11: 97,101,567	N226S	probably benign	Het
Tcrg-V1	T	A	13: 19,340,333	L76I	possibly damaging	Het
Thada	A	G	17: 84,435,650	L782P	probably damaging	Het
Tle1	T	G	4: 72,137,098	I446L	possibly damaging	Het
Triobp	A	G	15: 78,993,269	D1621G	probably damaging	Het
Trpm2	G	C	10: 77,938,138	A481G	probably benign	Het
Unc80	A	T	1: 66,646,436	M2240L	probably benign	Het
Usp9x	A	G	X: 13,123,508	R776G	possibly damaging	Homo
Vangl1	T	C	3: 102,166,922	T290A	probably benign	Het
Vmn1r233	T	A	17: 20,994,131	I186F	probably benign	Het
Vmn2r102	G	A	17: 19,681,162	C517Y	probably damaging	Het
Vrk2	G	A	11: 26,471,611	T449M	possibly damaging	Het
Zfp518a	A	G	19: 40,911,860	S78G	probably benign	Het
Zscan25	T	C	5: 145,286,310	S131P	unknown	Het
Zscan29	G	A	2: 121,166,615	T140I	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8686:Dnajc13	UTSW	9	104170805	missense	probably benign	0.00
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9353:Dnajc13	UTSW	9	104190372	missense	probably benign	0.31
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCACAAGCCAAGGTTACTC -3'
(R):5'- CTGCACAGCCTGAAATTGGAC -3'

Sequencing Primer
(F):5'- CTCACACATGATTCTCAGTGTATG -3'
(R):5'- ATCTTAAAGTTCAGGCTTTCACC -3'

Posted On

2015-10-08