Incidental Mutation 'R8680:Dnajc13'
ID 661693
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R8680 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104180139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1554 (V1554A)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: V1549A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: V1549A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: V1554A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: V1554A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,663 Y195C probably damaging Het
Abcb1a T A 5: 8,685,371 F159L probably damaging Het
Adam6b A G 12: 113,490,751 N396S probably benign Het
Adamts15 T C 9: 30,911,759 M338V possibly damaging Het
Adamts7 T A 9: 90,195,268 H1329Q probably damaging Het
Aim2 C T 1: 173,462,220 P243L probably damaging Het
Ankdd1a T C 9: 65,505,136 D311G probably damaging Het
Apon A T 10: 128,254,559 E35D probably benign Het
Atp1a4 T C 1: 172,250,999 D224G probably damaging Het
Atp6v0a1 T A 11: 101,062,403 *839R probably null Het
Bco2 A G 9: 50,550,578 L42P probably damaging Het
Bicral T A 17: 46,830,947 probably benign Het
Casc1 T A 6: 145,181,816 I456F probably benign Het
Ccna1 T C 3: 55,048,457 Q306R probably benign Het
Cep152 G T 2: 125,564,211 S1467* probably null Het
Cfap44 T A 16: 44,404,722 V110E probably damaging Het
Clip2 G A 5: 134,502,608 A781V probably benign Het
Cps1 A T 1: 67,204,613 I1083F probably damaging Het
Cux1 A G 5: 136,307,856 V934A possibly damaging Het
Depdc5 T C 5: 32,944,038 F891L possibly damaging Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eif6 T A 2: 155,822,852 D238V probably benign Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Fat2 G A 11: 55,253,866 L4061F probably benign Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gpr155 T C 2: 73,343,695 E790G probably damaging Het
Ighv1-67 A T 12: 115,604,241 V17E probably damaging Het
Klra9 T A 6: 130,188,676 R125S probably damaging Het
Leo1 T C 9: 75,445,995 probably null Het
Map2 G T 1: 66,421,713 R1556L probably damaging Het
Megf8 A G 7: 25,359,741 probably null Het
Meikin T C 11: 54,426,651 I426T possibly damaging Het
Muc16 A T 9: 18,644,719 V3426E unknown Het
Olfr1061 T C 2: 86,413,591 I154V probably benign Het
Olfr12 T C 1: 92,619,921 V5A probably benign Het
Olfr1234 T A 2: 89,362,721 Y236F probably benign Het
Olfr609 G A 7: 103,492,822 L19F probably damaging Het
Olfr668 A G 7: 104,925,413 L117P probably damaging Het
Olfr859 T G 9: 19,808,809 S164A possibly damaging Het
Otogl A G 10: 107,912,075 probably null Het
Palm3 T C 8: 84,029,875 L672P probably damaging Het
Perm1 A G 4: 156,217,634 T212A probably benign Het
Poc1a T C 9: 106,349,761 M400T probably benign Het
Pou6f2 T A 13: 18,239,611 Q193L unknown Het
Ppl C T 16: 5,087,436 R1665H probably benign Het
Ppp4r3b T C 11: 29,173,449 probably null Het
Ptger1 T C 8: 83,668,025 S44P probably damaging Het
Pzp T C 6: 128,496,046 T787A probably benign Het
Rab44 A T 17: 29,139,668 R277* probably null Het
Rasgef1a T A 6: 118,087,127 I334K probably damaging Het
Rfx1 T C 8: 84,091,455 V554A possibly damaging Het
Ripk1 T A 13: 34,030,049 I518K possibly damaging Het
Rpl22 A G 4: 152,332,306 Y90C probably damaging Het
Rps27a C A 11: 29,545,998 R118L probably benign Het
Scmh1 T A 4: 120,462,134 S19T probably benign Het
Scn10a C T 9: 119,691,443 probably null Het
Sema4c A T 1: 36,550,786 S496T probably benign Het
Serpina3i T C 12: 104,265,128 V8A possibly damaging Het
Sis G A 3: 72,960,295 T139M probably damaging Het
Slc45a2 T A 15: 11,000,886 S24T probably benign Het
Slc5a11 A G 7: 123,267,752 I423M probably benign Het
Slc7a10 G A 7: 35,186,572 G31S probably benign Het
Sowahc A G 10: 59,223,179 N379S probably benign Het
Stat5a T C 11: 100,883,888 M741T unknown Het
Tcf15 T C 2: 152,144,100 S159P probably benign Het
Tdrd5 C A 1: 156,271,218 R669L possibly damaging Het
Tln1 T C 4: 43,553,041 E350G possibly damaging Het
Trim12c T G 7: 104,348,064 N95T Het
Ttc37 A T 13: 76,155,468 H1227L probably benign Het
Urb1 T C 16: 90,774,625 T1099A probably benign Het
Vmn1r44 T A 6: 89,893,596 V108D probably damaging Het
Vmn2r65 A G 7: 84,940,180 Y843H probably benign Het
Vmn2r68 A G 7: 85,222,113 I654T possibly damaging Het
Vps13a T C 19: 16,645,906 N2797S possibly damaging Het
Wscd2 T C 5: 113,574,174 Y385H probably damaging Het
Xdh T C 17: 73,922,505 I318V probably benign Het
Xrcc3 T A 12: 111,807,879 K172M probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R7995:Dnajc13 UTSW 9 104174363 missense probably damaging 1.00
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8354:Dnajc13 UTSW 9 104217728 missense probably damaging 1.00
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8847:Dnajc13 UTSW 9 104180161 nonsense probably null
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9139:Dnajc13 UTSW 9 104207840 missense probably benign 0.02
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9470:Dnajc13 UTSW 9 104230720 missense probably benign 0.01
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGAAGCCGTCAACAG -3'
(R):5'- CGTCTTTGCACACTATGAGATG -3'

Sequencing Primer
(F):5'- GCCGTCAACAGCCACCTTC -3'
(R):5'- TTTGTACAAAGAGACAGCTAGTTGG -3'
Posted On 2021-03-08