Incidental Mutation 'R9139:Dnajc13'
ID 694222
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R9139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104207840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 791 (D791E)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: D786E

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: D791E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: D791E

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,281,546 V288A possibly damaging Het
Ankhd1 T A 18: 36,578,757 S135R Het
Axl G A 7: 25,761,421 T721I probably damaging Het
Blnk G A 19: 40,934,518 A388V probably benign Het
C8b T C 4: 104,784,434 V189A probably damaging Het
Ccdc33 G C 9: 58,076,559 I452M probably benign Het
Cfap57 T C 4: 118,554,851 T1199A probably benign Het
Chga G A 12: 102,561,885 V212M probably benign Het
Cspp1 T A 1: 10,116,650 M887K probably damaging Het
Cyp3a16 G C 5: 145,469,624 A6G unknown Het
Cyp4f17 G T 17: 32,524,894 E349* probably null Het
Dpysl5 T C 5: 30,778,053 Y167H probably benign Het
Dqx1 G T 6: 83,059,778 Q254H possibly damaging Het
Eef1g A G 19: 8,978,019 T411A probably benign Het
Fancl C A 11: 26,387,231 A6E probably benign Het
Gabrr3 A G 16: 59,407,467 Q29R probably benign Het
Gtf2h2 A C 13: 100,481,270 L168R probably damaging Het
Hacl1 T A 14: 31,616,381 Q413L probably benign Het
Hdc A T 2: 126,597,917 V372E probably damaging Het
Hr A T 14: 70,557,639 H208L possibly damaging Het
Htr6 T C 4: 139,062,190 R255G possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kank2 A G 9: 21,770,074 V747A probably damaging Het
Kif5c A G 2: 49,730,279 T508A probably benign Het
Klhdc8b A G 9: 108,449,728 V145A probably damaging Het
Klk1b21 T A 7: 44,105,500 V73D probably damaging Het
Ksr1 T A 11: 79,020,746 M737L probably benign Het
Macf1 T C 4: 123,434,771 Y4723C probably damaging Het
Mcm7 T C 5: 138,169,135 Y182C probably damaging Het
Mtf2 T C 5: 108,104,532 probably null Het
Nrxn2 A T 19: 6,448,269 T255S probably benign Het
Olfr1154 A T 2: 87,902,764 M304K probably benign Het
Olfr1418 A G 19: 11,855,302 L217P probably damaging Het
Olfr248 A T 1: 174,391,083 T5S probably damaging Het
Olfr30 T A 11: 58,455,173 T259S possibly damaging Het
Olfr552 T A 7: 102,604,978 I208N probably damaging Het
Olfr741 T C 14: 50,486,250 L264P probably damaging Het
Pamr1 T A 2: 102,634,421 V305E probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg10 C T 6: 4,757,128 T568M unknown Het
Polr3a A G 14: 24,469,348 F664S probably damaging Het
Prb1 T A 6: 132,208,343 N109I unknown Het
Prdm2 T C 4: 143,132,182 I1513V probably benign Het
Prkd3 A C 17: 78,962,540 V564G possibly damaging Het
Prss16 A G 13: 22,008,343 S151P probably damaging Het
Rnf150 C T 8: 82,863,959 probably benign Het
Rttn A G 18: 89,020,137 T786A probably benign Het
Scin A G 12: 40,063,237 V645A possibly damaging Het
Slc25a20 T A 9: 108,680,199 M177K probably benign Het
Slc2a6 G A 2: 27,024,322 S261L possibly damaging Het
Slc4a7 A T 14: 14,796,115 D1118V probably damaging Het
Slc7a2 T C 8: 40,905,672 W351R probably damaging Het
Sp8 G A 12: 118,848,439 G10S probably damaging Het
St8sia2 A G 7: 73,966,765 I175T probably damaging Het
Tas2r122 T A 6: 132,711,816 N38I probably benign Het
Trim31 C T 17: 36,898,490 T46M possibly damaging Het
Trim31 A G 17: 36,909,253 K354E probably benign Het
Trio G A 15: 27,749,836 Q2260* probably null Het
Trpm1 T C 7: 64,199,195 I63T probably benign Het
Ugt2b37 T C 5: 87,251,777 K291E probably benign Het
Usp54 T C 14: 20,577,094 T499A probably benign Het
Vmn1r35 T C 6: 66,678,949 I246V probably benign Het
Vmn2r6 A G 3: 64,556,856 S186P probably benign Het
Vmn2r76 T A 7: 86,229,962 M377L probably benign Het
Zeb2 A C 2: 44,988,625 M1243R possibly damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R7995:Dnajc13 UTSW 9 104174363 missense probably damaging 1.00
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8354:Dnajc13 UTSW 9 104217728 missense probably damaging 1.00
R8680:Dnajc13 UTSW 9 104180139 missense probably benign
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8847:Dnajc13 UTSW 9 104180161 nonsense probably null
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9470:Dnajc13 UTSW 9 104230720 missense probably benign 0.01
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAAGCAAAGACTAGAATTTCC -3'
(R):5'- CCTGCACAGCCTGAAATTGG -3'

Sequencing Primer
(F):5'- GTGAAGACAAAGCTGTACC -3'
(R):5'- CTGCACAGCCTGAAATTGGACATATG -3'
Posted On 2022-01-20