Mutagenetix > Incidental Mutations

Incidental Mutation 'R2206:Dnajc13'

239054

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

040208-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R2206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 104203518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 821 (V821L)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: V816L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: V816L

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185503

Predicted Effect

probably damaging
Transcript: ENSMUST00000186788
AA Change: V821L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: V821L

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189103

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,106	V300A	probably benign	Het
2310057M21Rik	A	T	7: 131,362,602	C24S	probably benign	Het
2410137M14Rik	A	G	17: 36,978,073		probably benign	Het
Abhd18	G	A	3: 40,910,573	G83D	probably benign	Het
Adam34	T	C	8: 43,652,237	I124V	probably benign	Het
Adck2	A	G	6: 39,583,839	D123G	probably damaging	Het
Arhgef2	A	G	3: 88,629,914	E37G	probably damaging	Het
Armc4	C	A	18: 7,223,676	G456W	probably benign	Het
Axl	T	C	7: 25,770,636	Y466C	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9a	A	T	2: 154,264,241		probably null	Het
Brip1	A	G	11: 86,061,877	V1026A	probably benign	Het
Cacna1h	A	T	17: 25,385,013	S1282T	probably benign	Het
Calcr	T	C	6: 3,717,133	Y109C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cst13	A	T	2: 148,823,282	R66W	probably damaging	Het
Cstf2t	A	G	19: 31,083,775	N237S	probably benign	Het
Dhx8	A	G	11: 101,750,971	T632A	probably benign	Het
Disp2	G	T	2: 118,792,244	Q1152H	probably benign	Het
Dlg1	A	G	16: 31,853,846	H599R	probably benign	Het
Dmxl1	T	C	18: 49,894,094	S2090P	probably benign	Het
Dopey1	T	A	9: 86,521,599	H1617Q	probably benign	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Ephb4	T	C	5: 137,357,719	C197R	probably damaging	Het
Foxn1	C	A	11: 78,358,804	A632S	probably benign	Het
Fpr3	A	C	17: 17,970,646	T60P	probably damaging	Het
Gja4	A	T	4: 127,312,617	S118T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itfg1	A	T	8: 85,776,198	S246R	probably benign	Het
Kazn	A	T	4: 142,118,292		probably null	Het
Mdn1	T	C	4: 32,716,271	L2111P	possibly damaging	Het
Myo6	A	G	9: 80,258,455	Y374C	probably benign	Het
Olfr1160	A	G	2: 88,006,235	V181A	probably benign	Het
Olfr1451	A	G	19: 12,999,040	D18G	probably benign	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr403	G	T	11: 74,196,324	V274L	possibly damaging	Het
Pcdhb15	A	T	18: 37,475,022	T436S	probably benign	Het
Pcdhb18	T	A	18: 37,491,289	N557K	probably damaging	Het
Pcdhb6	T	C	18: 37,335,580	M518T	probably benign	Het
Pcmtd1	A	T	1: 7,169,583	I83L	probably benign	Het
Pitrm1	T	A	13: 6,569,291	Y721N	probably damaging	Het
Prcp	C	T	7: 92,928,612	T328I	probably damaging	Het
Psg27	C	A	7: 18,567,111	E6*	probably null	Het
Pth1r	T	A	9: 110,723,587	E465V	probably damaging	Het
Pus7l	T	C	15: 94,523,590	Y613C	probably damaging	Het
Rsl1	A	G	13: 67,182,828	T447A	probably benign	Het
Setd3	C	T	12: 108,107,285	V578M	probably benign	Het
Slc10a1	T	C	12: 80,967,628	N106S	probably damaging	Het
Slc29a3	T	C	10: 60,715,907	M453V	possibly damaging	Het
Slc4a8	T	C	15: 100,807,445	V844A	probably damaging	Het
Sorcs1	T	C	19: 50,230,217	H609R	possibly damaging	Het
Tmppe	C	G	9: 114,405,572	P313R	probably benign	Het
Tnxb	A	C	17: 34,709,417	T2602P	possibly damaging	Het
Trip11	T	C	12: 101,873,442	N1643S	probably benign	Het
Trmt1l	T	C	1: 151,435,843		probably null	Het
Vmn1r177	A	T	7: 23,866,131	C107S	probably damaging	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vmn1r232	A	G	17: 20,914,203	L45P	probably benign	Het
Wdr7	T	A	18: 63,777,607	V690E	possibly damaging	Het
Xaf1	A	T	11: 72,303,402	E36D	possibly damaging	Het
Zbtb40	G	A	4: 137,017,285	Q275*	probably null	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8686:Dnajc13	UTSW	9	104170805	missense	probably benign	0.00
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9353:Dnajc13	UTSW	9	104190372	missense	probably benign	0.31
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGATGGTAGAGCTCATTG -3'
(R):5'- AGCTGGTCTAGACAAGATGGC -3'

Sequencing Primer
(F):5'- CGATGGTAGAGCTCATTGAAAAACTC -3'
(R):5'- GCTACACCAAGAAACTCTGT -3'

Posted On

2014-10-02