Mutagenetix > Incidental Mutations

Incidental Mutation 'R4795:Abca4'

368910

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

MMRRC Submission

041996-MU

Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4795 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 122176123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 2259 (L2259R)

Ref Sequence

ENSEMBL: ENSMUSP00000013995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]

AlphaFold

O35600

Predicted Effect

probably damaging
Transcript: ENSMUST00000013995
AA Change: L2259R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: L2259R

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136358

Predicted Effect

probably damaging
Transcript: ENSMUST00000141135
AA Change: L1051R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: L1051R

Domain	Start	End	E-Value	Type
Blast:AAA	1	172	9e-78	BLAST
Pfam:ABC2_membrane_3	311	686	1.9e-42	PFAM
AAA	755	939	1.2e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198484

Meta Mutation Damage Score

0.2493

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (123/125)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acd	A	G	8: 105,701,015	S2P	possibly damaging	Het
Acsf3	A	G	8: 122,780,157	Y63C	possibly damaging	Het
Adam21	T	C	12: 81,560,974	I5V	probably benign	Het
Adamts6	C	A	13: 104,444,128	S783*	probably null	Het
Adamtsl1	T	C	4: 86,243,769		probably null	Het
Adck2	T	A	6: 39,576,393	S313T	probably benign	Het
Adgb	A	G	10: 10,357,872	I1285T	probably benign	Het
Angptl1	T	A	1: 156,860,583	M485K	possibly damaging	Het
Ank3	G	A	10: 69,858,265	V289I	probably benign	Het
Atp13a4	A	G	16: 29,490,008		probably null	Het
Atp1a1	A	G	3: 101,583,775	L648P	probably benign	Het
Atp2a3	A	G	11: 72,973,029	I194V	probably benign	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Ccdc112	T	A	18: 46,287,672	Q337L	probably benign	Het
Cd34	T	G	1: 194,951,011	S194A	probably damaging	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Commd9	A	G	2: 101,898,896	N116D	probably benign	Het
Dab2	C	A	15: 6,429,611	P335T	probably benign	Het
Epb41l3	T	A	17: 69,248,719		probably null	Het
Epha2	A	G	4: 141,322,416		probably null	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Glyr1	A	C	16: 5,047,758	V44G	probably benign	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm18856	C	A	13: 13,965,208		probably benign	Het
Gm44501	A	G	17: 40,578,714	K40E	probably benign	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Hdhd5	T	C	6: 120,523,446	H97R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hsf5	A	G	11: 87,635,620	M373V	probably benign	Het
Igbp1b	C	T	6: 138,657,805	E214K	probably benign	Het
Iigp1	T	A	18: 60,389,892	F27L	probably benign	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Kbtbd3	G	A	9: 4,331,073	W482*	probably null	Het
Kcnq1	A	G	7: 143,182,757	T168A	probably benign	Het
Lrch3	A	G	16: 33,005,704	N631S	probably damaging	Het
Lrrk1	T	A	7: 66,262,665	I1716F	possibly damaging	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Map4	T	C	9: 110,035,263	S519P	probably benign	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc5b	A	G	7: 141,849,567	E755G	unknown	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Necab1	G	T	4: 15,111,208	D73E	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nfyb	A	T	10: 82,752,368		probably benign	Het
Nol4	T	C	18: 22,921,887	Q162R	probably damaging	Het
Nwd2	G	A	5: 63,805,433	D787N	probably benign	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr205	C	T	16: 59,328,850	V220I	probably benign	Het
Olfr49	A	G	14: 54,282,547	M116T	probably damaging	Het
Olfr535	A	G	7: 140,493,007	D123G	probably damaging	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr740	A	C	14: 50,453,417	M122L	probably damaging	Het
Olfr908	T	A	9: 38,516,503	M157K	probably damaging	Het
Orai3	T	C	7: 127,773,888	V187A	probably benign	Het
Parn	T	C	16: 13,606,202	T444A	probably benign	Het
Pcdh11x	A	C	X: 120,400,240	N460T	probably damaging	Het
Pcnt	C	T	10: 76,370,024	R2516H	probably benign	Het
Pde4d	T	A	13: 109,938,171		probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pgm1	A	G	5: 64,103,874	Y237C	probably damaging	Het
Plcb2	A	G	2: 118,711,124	V975A	probably benign	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp6r1	C	T	7: 4,641,054	V430M	possibly damaging	Het
Ptges2	C	A	2: 32,396,322	C16*	probably null	Het
Relb	A	T	7: 19,619,839	I38N	probably damaging	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Samsn1	A	G	16: 75,883,845		probably benign	Het
Scrn1	A	G	6: 54,520,769	V279A	possibly damaging	Het
Sec31b	A	G	19: 44,531,746	S200P	probably benign	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Slit3	G	A	11: 35,651,820		probably null	Het
Smo	T	A	6: 29,755,574	V415E	probably damaging	Het
Spag8	C	A	4: 43,652,035	V350L	possibly damaging	Het
Tbck	T	G	3: 132,707,798	L132R	possibly damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tm9sf2	T	A	14: 122,149,840		probably null	Het
Tmem131	A	G	1: 36,841,676	V171A	probably damaging	Het
Tmem209	T	C	6: 30,501,955	T83A	probably benign	Het
Tmem63a	T	C	1: 180,954,851	Y138H	probably damaging	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Trpv2	A	G	11: 62,581,180	D66G	possibly damaging	Het
Trrap	T	A	5: 144,832,488	I2620N	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Ube2dnl1	G	A	X: 114,905,785	C119Y	possibly damaging	Het
Unc13c	T	A	9: 73,932,187	S461C	probably damaging	Het
Unc80	T	G	1: 66,527,941	I902S	probably damaging	Het
Usp42	C	A	5: 143,723,937	G170W	probably damaging	Het
Vldlr	T	C	19: 27,238,852		probably null	Het
Ywhab	A	G	2: 164,015,345	Y180C	probably damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp318	A	G	17: 46,412,062	T1664A	probably benign	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het
Zfp768	T	C	7: 127,343,375	Q527R	possibly damaging	Het
Zfp975	T	A	7: 42,665,146		probably null	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1763:Abca4	UTSW	3	122163830	missense	probably damaging	1.00
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4668:Abca4	UTSW	3	122155299	missense	possibly damaging	0.90
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6681:Abca4	UTSW	3	122121798	missense	probably damaging	1.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7758:Abca4	UTSW	3	122128167	missense	probably damaging	1.00
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CTAAGAAGCAAGCCGTGTCC -3'
(R):5'- TGAGCTCCTACTAGAGAACCCC -3'

Sequencing Primer
(F):5'- ACAACTGTGGAGACCTGCGAC -3'
(R):5'- TACTAGAGAACCCCTGGGC -3'

Posted On

2016-02-04