Mutagenetix > Incidental Mutation

Incidental Mutation 'R9751:Abca4'

732502

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

MMRRC Submission

Accession Numbers

Genbank: NM_007378; MGI: 109424

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9751 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122087477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 514 (N514D)

Ref Sequence

ENSEMBL: ENSMUSP00000013995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995]

AlphaFold

O35600

Predicted Effect

probably benign
Transcript: ENSMUST00000013995
AA Change: N514D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: N514D

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,011,740	I54M		Het
Adgre1	G	A	17: 57,450,101	R786H	probably null	Het
Ankrd7	G	A	6: 18,868,025	V97I	probably damaging	Het
Bmper	C	T	9: 23,406,713	P543S	possibly damaging	Het
Brwd1	A	T	16: 95,993,815	M2233K	possibly damaging	Het
C1s2	G	T	6: 124,625,594	P553T	probably damaging	Het
Cachd1	G	A	4: 100,966,241	V497I	possibly damaging	Het
Cacng4	A	G	11: 107,735,193	S191P	probably damaging	Het
Cd109	C	A	9: 78,698,160	T1015K	probably damaging	Het
Clstn2	A	G	9: 97,457,650	L756P	probably damaging	Het
Crybg3	A	T	16: 59,557,524	D1122E	possibly damaging	Het
Csf2	A	T	11: 54,249,594	L6*	probably null	Het
Csnk1g2	T	A	10: 80,637,911	Y71N	possibly damaging	Het
Dlg2	C	A	7: 90,915,523	H116N	probably benign	Het
Dnah14	C	T	1: 181,792,045	S3978L	probably damaging	Het
Dpp8	C	T	9: 65,053,171	T328I	probably null	Het
Dysf	T	C	6: 84,186,468	V1625A	probably damaging	Het
Egf	C	A	3: 129,754,889	V26F	probably damaging	Het
Fam126a	C	T	5: 23,991,750	E47K	probably benign	Het
Fam20a	T	A	11: 109,675,166	Y414F	probably damaging	Het
Fsip2	T	C	2: 82,987,897	I4658T	probably benign	Het
Gm11639	G	A	11: 104,893,085	G2754E	probably benign	Het
Gm21319	T	C	12: 87,773,756	N11S	possibly damaging	Het
Igflr1	A	T	7: 30,567,228	Q167L	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Map3k6	A	G	4: 133,251,857		probably null	Het
Mcpt4	A	G	14: 56,060,054	I215T	probably damaging	Het
Med13	T	C	11: 86,299,158	Y975C	probably damaging	Het
Meioc	T	A	11: 102,675,593	Y678*	probably null	Het
Myof	T	C	19: 37,936,370	T1190A	probably benign	Het
Nap1l4	A	C	7: 143,534,395		probably benign	Het
Ncapg	T	C	5: 45,693,853	V796A	probably damaging	Het
Olfr1167	T	A	2: 88,149,270	I250L	probably benign	Het
Olfr1168	T	A	2: 88,184,916	V13E	possibly damaging	Het
Olfr1224-ps1	C	T	2: 89,156,438	V246M	possibly damaging	Het
Olfr1257	C	T	2: 89,881,612	T262I	probably benign	Het
Olfr493	T	C	7: 108,346,438	Y181C	probably benign	Het
Paxbp1	A	G	16: 91,027,300	S515P	probably benign	Het
Plce1	C	T	19: 38,728,970	S1401F	probably damaging	Het
Rptor	A	G	11: 119,887,138	K1043E	probably benign	Het
Rtn4rl2	T	G	2: 84,880,695	N75T	probably damaging	Het
Slc35f4	A	G	14: 49,298,834	I448T	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tas2r115	A	G	6: 132,737,955	I11T	possibly damaging	Het
Tbc1d5	A	G	17: 50,874,652	V351A	possibly damaging	Het
Tmem55b	A	G	14: 50,927,979	V257A	probably benign	Het
Trim43b	A	T	9: 89,089,517	D195E	probably benign	Het
Trim65	C	A	11: 116,130,738	A90S	probably benign	Het
Trip11	C	T	12: 101,884,506	V1100I	possibly damaging	Het
Tyrp1	A	G	4: 80,840,775	E295G	probably null	Het
Ube2g2	G	A	10: 77,644,473	V138I	probably benign	Het
Wdr60	T	A	12: 116,241,783		probably null	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1763:Abca4	UTSW	3	122163830	missense	probably damaging	1.00
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4668:Abca4	UTSW	3	122155299	missense	possibly damaging	0.90
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4795:Abca4	UTSW	3	122176123	missense	probably damaging	0.99
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6681:Abca4	UTSW	3	122121798	missense	probably damaging	1.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7758:Abca4	UTSW	3	122128167	missense	probably damaging	1.00
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
R9464:Abca4	UTSW	3	122120065	missense	probably benign	0.08
R9483:Abca4	UTSW	3	122085626	missense
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TAAGGCCAAAGAGCCTGTG -3'
(R):5'- AAGATGCTGTCAGATGGCCG -3'

Sequencing Primer
(F):5'- GCCAAAGAGCCTGTGGAATTC -3'
(R):5'- AGATGGCCGTGGACCCTTATG -3'

Posted On

2022-11-14