Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Olfr95'

456471

Institutional Source

Beutler Lab

Gene Symbol

Olfr95

Ensembl Gene

ENSMUSG00000049561

Gene Name

olfactory receptor 95

Synonyms

MOR263-6, GA_x6K02T2PSCP-1651760-1650822

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37207950-37213118 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 37211021 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 277 (Y277*)

Ref Sequence

ENSEMBL: ENSMUSP00000150480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]

Predicted Effect

probably null
Transcript: ENSMUST00000060728
AA Change: Y277*

SMART Domains

Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: Y277*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	1.9e-57	PFAM
Pfam:7TM_GPCR_Srsx	34	259	1.7e-6	PFAM
Pfam:7tm_1	40	289	2.2e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000216318
AA Change: Y277*

Meta Mutation Damage Score

0.9716

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Olfr95

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02147:Olfr95	APN	17	37210986	missense	probably damaging	1.00
IGL03306:Olfr95	APN	17	37211677	missense	probably damaging	1.00
PIT4377001:Olfr95	UTSW	17	37211089	missense	probably benign	0.00
R0668:Olfr95	UTSW	17	37211644	missense	probably damaging	1.00
R0909:Olfr95	UTSW	17	37210918	missense	probably benign	0.33
R1442:Olfr95	UTSW	17	37211704	missense	probably benign	0.00
R1557:Olfr95	UTSW	17	37211353	missense	probably damaging	1.00
R1758:Olfr95	UTSW	17	37211313	missense	possibly damaging	0.88
R3195:Olfr95	UTSW	17	37211536	missense	possibly damaging	0.87
R3749:Olfr95	UTSW	17	37211800	missense	possibly damaging	0.55
R3778:Olfr95	UTSW	17	37211758	missense	probably benign
R4458:Olfr95	UTSW	17	37211313	missense	possibly damaging	0.88
R4591:Olfr95	UTSW	17	37211119	missense	probably benign
R5058:Olfr95	UTSW	17	37211667	missense	probably damaging	1.00
R5060:Olfr95	UTSW	17	37211416	missense	probably benign	0.00
R6294:Olfr95	UTSW	17	37211626	missense	probably benign	0.19
R6689:Olfr95	UTSW	17	37211157	missense	probably damaging	1.00
R7196:Olfr95	UTSW	17	37211193	missense	probably damaging	1.00
R7677:Olfr95	UTSW	17	37211495	nonsense	probably null
R8132:Olfr95	UTSW	17	37211316	missense	probably damaging	1.00
R8340:Olfr95	UTSW	17	37211184	missense	possibly damaging	0.78
R8380:Olfr95	UTSW	17	37211341	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ATGTTGAGGGAGTCAATAGCTC -3'
(R):5'- TTCTTAGCTCCTACGGACGG -3'

Sequencing Primer
(F):5'- TGAGGGAGTCAATAGCTCTTTAAG -3'
(R):5'- TAGCTCCTACGGACGGATCCTG -3'

Posted On

2017-02-15