Incidental Mutation 'R5954:Dock8'
ID471080
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 044143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5954 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25171619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1487 (R1487Q)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025831
AA Change: R1487Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: R1487Q

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,416 I944T probably benign Het
Ank2 T C 3: 126,997,861 T823A probably benign Het
Ankrd42 C G 7: 92,623,967 probably null Het
Anks4b T A 7: 120,182,173 N142K possibly damaging Het
Armc5 A G 7: 128,242,272 E484G probably benign Het
B4galnt3 A G 6: 120,225,188 F118L possibly damaging Het
Bbs12 C T 3: 37,320,002 L200F possibly damaging Het
Cacna1h A G 17: 25,383,201 F1555S probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Chd6 A C 2: 160,965,827 H1822Q probably benign Het
Chdh C T 14: 30,031,181 R16C possibly damaging Het
Cnga1 T C 5: 72,604,878 D431G probably damaging Het
Farp1 T A 14: 121,222,667 V116D probably damaging Het
Fbxo24 T A 5: 137,619,681 T274S probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gatad2b T C 3: 90,351,441 L257P probably damaging Het
Gm20402 C T 3: 52,268,890 P30L probably damaging Het
Gm7932 C T 6: 48,862,859 noncoding transcript Het
Gpatch8 A T 11: 102,480,941 D590E unknown Het
Herc1 T G 9: 66,451,492 probably benign Het
Hsd3b2 T A 3: 98,711,559 I357F probably benign Het
Ipo5 A G 14: 120,919,984 Y78C probably damaging Het
Itga8 C A 2: 12,132,486 A23S probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat2a A G 11: 100,708,898 V451A possibly damaging Het
Knstrn A G 2: 118,830,955 probably benign Het
Med23 A G 10: 24,870,483 probably benign Het
Mefv A G 16: 3,715,715 Y231H probably benign Het
Olfr1425 A T 19: 12,074,083 I183N possibly damaging Het
Olfr1507 T A 14: 52,490,167 I266F probably benign Het
Olfr494 T A 7: 108,367,601 I37N probably damaging Het
Olfr935 A G 9: 38,995,415 S7P probably damaging Het
Pak7 G T 2: 136,116,463 T235K probably benign Het
Plppr3 G T 10: 79,866,126 P294Q probably benign Het
Prepl A G 17: 85,064,649 F725L probably benign Het
Ptchd3 A T 11: 121,836,587 probably benign Het
Rprd2 T C 3: 95,764,863 E1076G probably damaging Het
Sarm1 C A 11: 78,490,602 E352* probably null Het
Sccpdh T A 1: 179,680,588 H14Q probably benign Het
Senp7 A G 16: 56,169,871 I661V probably benign Het
Sept3 T C 15: 82,290,427 F140L probably damaging Het
Spag6 G T 2: 18,710,606 Q65H probably damaging Het
Tnni3 C T 7: 4,519,540 R137H probably damaging Het
Trank1 A G 9: 111,365,133 S742G probably benign Het
Ucn3 T C 13: 3,941,413 I80V probably benign Het
Ulk2 A T 11: 61,803,796 probably benign Het
Uncx C T 5: 139,547,629 S483L probably benign Het
Vps39 A G 2: 120,324,662 V550A probably damaging Het
Zfp697 C A 3: 98,428,593 T558K probably damaging Het
Zfp790 G T 7: 29,829,504 G538V probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATCAGTCCTCTAAGATAATCAGCAGC -3'
(R):5'- ATGGTTTGGCTTCCCCACAG -3'

Sequencing Primer
(F):5'- GATAATCAGCAGCCGCCTCTC -3'
(R):5'- CCACAGTGAGTCTCTGAAAATCAGTG -3'
Posted On2017-03-31