Incidental Mutation 'R6923:Dock8'
ID 539763
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 045381-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6923 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25072970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 417 (T417S)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: T417S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: T417S

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Albfm1 A G 5: 90,725,652 (GRCm39) N288S probably benign Het
Ap4b1 T A 3: 103,719,530 (GRCm39) D81E probably benign Het
Atg16l1 A T 1: 87,702,078 (GRCm39) probably null Het
Atp11a A G 8: 12,906,949 (GRCm39) T459A probably damaging Het
Bloc1s5 T A 13: 38,815,040 (GRCm39) I40F probably damaging Het
Bltp2 T A 11: 78,165,452 (GRCm39) S1323T possibly damaging Het
Capn5 T A 7: 97,778,461 (GRCm39) Q386L probably damaging Het
Cbfa2t2 C T 2: 154,376,903 (GRCm39) H529Y probably damaging Het
Cd3d T C 9: 44,897,157 (GRCm39) probably benign Het
Cenpa A G 5: 30,829,806 (GRCm39) probably null Het
Chit1 A T 1: 134,077,163 (GRCm39) Y322F probably null Het
Cntnap5c T A 17: 58,399,345 (GRCm39) N399K possibly damaging Het
Firrm A G 1: 163,814,454 (GRCm39) probably null Het
Fkbp2 A G 19: 6,956,537 (GRCm39) Het
Fsip1 G A 2: 118,080,394 (GRCm39) R121C probably benign Het
Gbp2b T C 3: 142,306,320 (GRCm39) I131T probably benign Het
Gm12695 T C 4: 96,658,053 (GRCm39) N39D probably benign Het
Gm4922 T C 10: 18,659,616 (GRCm39) R369G probably damaging Het
Gpatch3 C T 4: 133,309,836 (GRCm39) L390F probably damaging Het
Gpd2 G A 2: 57,245,800 (GRCm39) M443I probably damaging Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Hdac1-ps A G 17: 78,800,343 (GRCm39) T445A possibly damaging Het
Jph3 A G 8: 122,480,110 (GRCm39) T263A possibly damaging Het
Me3 C A 7: 89,495,093 (GRCm39) A337E probably damaging Het
Mndal A C 1: 173,712,264 (GRCm39) probably null Het
Msantd5l C T 11: 51,144,808 (GRCm39) D158N probably damaging Het
Muc6 C T 7: 141,217,453 (GRCm39) E2342K possibly damaging Het
Neb A G 2: 52,076,076 (GRCm39) V5659A probably damaging Het
Nkapd1 T A 9: 50,521,610 (GRCm39) I104L probably benign Het
Nrxn1 G A 17: 91,395,661 (GRCm39) A165V probably benign Het
Or5b94 T A 19: 12,652,409 (GRCm39) I280N possibly damaging Het
Or5b97 T C 19: 12,878,676 (GRCm39) N156S probably benign Het
Orc2 A G 1: 58,539,534 (GRCm39) L35S probably benign Het
Pax4 A G 6: 28,447,118 (GRCm39) probably null Het
Pcdhb7 C T 18: 37,475,522 (GRCm39) probably null Het
Pla2r1 C T 2: 60,345,310 (GRCm39) E349K probably benign Het
Polr2a C T 11: 69,626,787 (GRCm39) A1516T probably benign Het
Pramel23 A T 4: 143,425,676 (GRCm39) I89N probably benign Het
Prpf38a G T 4: 108,427,401 (GRCm39) D187E possibly damaging Het
Rdh16f1 T A 10: 127,624,737 (GRCm39) probably null Het
S100z T A 13: 95,615,090 (GRCm39) D25V probably damaging Het
Scamp2 T G 9: 57,488,895 (GRCm39) F199V probably damaging Het
Semp2l2b C A 10: 21,943,654 (GRCm39) G109C probably damaging Het
Senp2 T G 16: 21,830,326 (GRCm39) probably benign Het
Sltm T A 9: 70,481,892 (GRCm39) S365T probably damaging Het
Smg6 C G 11: 74,820,169 (GRCm39) P147A possibly damaging Het
Spem2 T A 11: 69,708,603 (GRCm39) R121W probably damaging Het
Sufu A G 19: 46,439,405 (GRCm39) probably null Het
Syt2 T C 1: 134,674,501 (GRCm39) V313A possibly damaging Het
Tet2 C T 3: 133,185,102 (GRCm39) probably null Het
Tfeb T A 17: 48,097,908 (GRCm39) I232N probably benign Het
Ticrr T G 7: 79,341,601 (GRCm39) I1062M probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vrk2 G A 11: 26,439,893 (GRCm39) A226V probably damaging Het
Wnk1 A T 6: 119,942,639 (GRCm39) probably benign Het
Xpo4 G T 14: 57,841,168 (GRCm39) T505K probably benign Het
Yy1 A T 12: 108,759,594 (GRCm39) I86F probably benign Het
Zc3h15 A G 2: 83,487,400 (GRCm39) D73G possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCAGACAACTTGGTGCTG -3'
(R):5'- TGCTCACAGTAATTGTTTCGGG -3'

Sequencing Primer
(F):5'- ACAACTTGGTGCTGACGCTTTG -3'
(R):5'- CTGACCAAGCATGTGCAGTTTAGTC -3'
Posted On 2018-11-06