Mutagenetix > Incidental Mutations

Incidental Mutation 'R6041:Lrrk1'

483547

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

044209-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6041 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66262133 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1893 (D1893G)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: D1893G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D1893G

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131239

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137181

Predicted Effect

probably benign
Transcript: ENSMUST00000145954

SMART Domains

Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
low complexity region	124	137	N/A	INTRINSIC
Pfam:Pkinase	158	435	6.6e-46	PFAM
Pfam:Pkinase_Tyr	159	435	5.8e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167705

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,376,380	M297K	probably damaging	Het
Ace	A	C	11: 105,975,308	H34P	probably benign	Het
Agbl2	A	T	2: 90,808,027	N652I	probably benign	Het
Auh	T	A	13: 52,919,086	L86F	possibly damaging	Het
Bmp10	A	G	6: 87,434,320	K365R	probably damaging	Het
Cacna1d	A	T	14: 30,042,357	S2086T	probably damaging	Het
Calcoco1	C	A	15: 102,717,939	R105L	possibly damaging	Het
Casc3	T	G	11: 98,828,559	V509G	probably damaging	Het
Clmn	A	G	12: 104,781,872	V472A	probably benign	Het
Cyp2b19	A	T	7: 26,759,427	S142C	probably damaging	Het
Derl3	T	C	10: 75,893,501	L26P	probably damaging	Het
Dgkh	C	T	14: 78,587,627	A863T	probably damaging	Het
Dhx30	C	T	9: 110,084,598	R1127Q	probably benign	Het
Dmxl2	A	G	9: 54,416,753	S1116P	probably damaging	Het
Dnah7b	T	C	1: 46,289,645	V3179A	probably benign	Het
Dnajb11	A	T	16: 22,868,721	N156I	probably benign	Het
Dpep1	A	T	8: 123,200,655	E316V	probably damaging	Het
F2rl2	T	A	13: 95,701,109	F221I	probably benign	Het
Fam189a2	A	T	19: 23,984,829	M270K	probably benign	Het
Flg2	T	A	3: 93,220,361	D173E	probably benign	Het
Fshr	A	T	17: 88,985,986	D421E	probably damaging	Het
Gfm2	T	A	13: 97,172,623	V612E	probably benign	Het
Gm17655	T	G	5: 110,047,573	K114N	possibly damaging	Het
Gm45844	C	A	7: 7,278,184		probably benign	Het
Gm5724	A	C	6: 141,739,038	D230E	probably benign	Het
Gpr142	A	T	11: 114,806,377	I250F	probably damaging	Het
Hexa	A	G	9: 59,563,236	Q447R	probably damaging	Het
Leng8	T	C	7: 4,145,569	L780P	probably benign	Het
Macf1	T	A	4: 123,513,848	I139F	probably damaging	Het
Megf10	A	T	18: 57,180,549	T22S	probably benign	Het
Mup-ps1	C	A	4: 60,088,549		noncoding transcript	Het
Myh13	A	T	11: 67,364,730	E1642V	probably damaging	Het
Myof	A	G	19: 37,924,620	Y1462H	probably damaging	Het
Nipbl	T	A	15: 8,324,264	D1765V	probably damaging	Het
Npy5r	A	T	8: 66,682,023	N39K	possibly damaging	Het
Olfr1026	G	A	2: 85,923,391	G41D	probably damaging	Het
Pax6	A	G	2: 105,683,902	I29V	probably damaging	Het
Pi4ka	A	G	16: 17,360,572	Y307H	probably benign	Het
Pmf1	A	C	3: 88,396,051	Y68D	probably damaging	Het
Psen2	C	A	1: 180,245,727	E10*	probably null	Het
Ptprs	T	A	17: 56,419,080	M991L	probably benign	Het
R3hdm4	A	G	10: 79,913,661	V20A	possibly damaging	Het
Rad17	T	C	13: 100,617,766	N649D	probably benign	Het
Rad9b	A	T	5: 122,351,352	C38S	probably damaging	Het
Rapgef2	T	C	3: 79,069,162	M1296V	probably benign	Het
Rbp3	T	C	14: 33,956,482	S796P	probably damaging	Het
Rpl10-ps3	A	G	9: 50,344,782	S54P	probably benign	Het
Sclt1	T	A	3: 41,627,177	I688F	probably damaging	Het
Scn10a	A	G	9: 119,609,469	I1778T	probably damaging	Het
Scrib	C	T	15: 76,067,172	R159Q	possibly damaging	Het
Senp1	C	T	15: 98,058,216	E441K	probably damaging	Het
Sipa1l1	T	A	12: 82,342,250	F417I	probably damaging	Het
Smcr8	A	G	11: 60,779,568	D514G	probably damaging	Het
Tbc1d23	T	G	16: 57,173,150	D551A	probably benign	Het
Tet1	G	T	10: 62,813,373	T149N	probably damaging	Het
Them4	A	T	3: 94,317,499	D61V	possibly damaging	Het
Trak1	A	T	9: 121,460,412	I597F	probably damaging	Het
Trank1	A	G	9: 111,377,796	I1666V	possibly damaging	Het
Vipr2	A	C	12: 116,142,984	N378T	probably damaging	Het
Zfp804b	T	C	5: 6,771,231	R575G	probably benign	Het
Zfp941	A	T	7: 140,812,245	C400*	probably null	Het
Zswim5	A	C	4: 116,962,621	S408R	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTCTAAAACCGAATGGCAAGGC -3'
(R):5'- TCACCGACTACTGCTCCATG -3'

Sequencing Primer
(F):5'- CAGATGGACCTGGGAATCTTTAAG -3'
(R):5'- GACTACTGCTCCATGTCCTC -3'

Posted On

2017-07-14