Incidental Mutation 'R6041:Lrrk1'
ID483547
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6041 (G1)
Quality Score216.009
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66262133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1893 (D1893G)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
AA Change: D1893G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D1893G

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137181
Predicted Effect probably benign
Transcript: ENSMUST00000145954
SMART Domains Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
Pfam:Pkinase 158 435 6.6e-46 PFAM
Pfam:Pkinase_Tyr 159 435 5.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167705
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
halide UTSW 7 66265474 missense possibly damaging 0.82
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
R7984:Lrrk1 UTSW 7 66300729 splice site probably null
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 66292315 missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCTAAAACCGAATGGCAAGGC -3'
(R):5'- TCACCGACTACTGCTCCATG -3'

Sequencing Primer
(F):5'- CAGATGGACCTGGGAATCTTTAAG -3'
(R):5'- GACTACTGCTCCATGTCCTC -3'
Posted On2017-07-14