Mutagenetix > Incidental Mutation

Incidental Mutation 'R2140:Lrrk1'

236134

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

040143-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2140 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66330750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 227 (D227E)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: D227E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D227E

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Meta Mutation Damage Score

0.1953

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	T	C	14: 4,348,902	I21T	probably damaging	Het
9230110C19Rik	T	C	9: 8,022,477	D248G	probably damaging	Het
Adgrf1	A	C	17: 43,300,802	E186D	probably damaging	Het
Adgrf4	C	T	17: 42,666,898	R518Q	possibly damaging	Het
Afdn	A	G	17: 13,810,433	E202G	probably damaging	Het
Agfg2	T	A	5: 137,667,116	R126W	probably damaging	Het
Alkbh2	C	T	5: 114,125,716	V77I	probably benign	Het
Alppl2	A	G	1: 87,087,697	S381P	probably benign	Het
Aqp2	A	G	15: 99,579,366	T72A	probably damaging	Het
Atp9b	A	G	18: 80,736,087	C1123R	probably damaging	Het
AU016765	T	A	17: 64,520,000		noncoding transcript	Het
Bscl2	T	C	19: 8,845,320		probably null	Het
Ccdc80	A	T	16: 45,127,446	Y929F	probably damaging	Het
Cenpj	T	C	14: 56,526,932	D1341G	probably damaging	Het
Cir1	A	T	2: 73,312,437	S18T	probably damaging	Het
Clcn6	A	G	4: 148,024,137	F145S	possibly damaging	Het
Cnksr1	A	G	4: 134,229,628	Y488H	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Crb1	T	C	1: 139,237,012	I1125V	probably benign	Het
Cyp3a13	A	T	5: 137,921,454	V20D	possibly damaging	Het
Dars	T	A	1: 128,372,162	M362L	probably benign	Het
Dck	T	C	5: 88,772,723	C101R	probably damaging	Het
Dnah11	T	C	12: 118,008,810	T2880A	probably benign	Het
Dnah7b	T	A	1: 46,268,670	M3048K	probably damaging	Het
Eef1a2	C	T	2: 181,148,742	E374K	probably benign	Het
Eif3a	A	T	19: 60,775,394		probably benign	Het
Esco1	A	G	18: 10,574,873		probably null	Het
Exoc8	C	T	8: 124,897,415	R71Q	possibly damaging	Het
Fam208a	C	T	14: 27,480,035	T1462I	probably damaging	Het
Far1	G	A	7: 113,566,460	V445M	possibly damaging	Het
Fbn1	C	A	2: 125,343,810	C1648F	probably damaging	Het
Fmn1	A	G	2: 113,595,048	K1189R	probably benign	Het
Foxl2	C	A	9: 98,956,487	P276H	unknown	Het
Fpr3	T	A	17: 17,970,617	V50E	probably damaging	Het
Garem1	T	A	18: 21,129,374	R794S	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Glyatl3	T	C	17: 40,911,084	D93G	probably benign	Het
Gm14124	A	T	2: 150,269,361	H657L	probably benign	Het
Gm4787	A	G	12: 81,378,562	I274T	probably benign	Het
Gucy1a1	C	T	3: 82,118,886		probably null	Het
Hook1	GATGAATGA	GATGA	4: 96,013,312	503	probably null	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Ints13	A	G	6: 146,576,431	S7P	probably damaging	Het
Kat5	T	A	19: 5,605,685		probably null	Het
Kcnma1	A	C	14: 23,314,220	L988R	probably damaging	Het
Kcnq3	C	A	15: 66,005,978		probably benign	Het
Kctd16	A	G	18: 40,259,178	E273G	possibly damaging	Het
Krt82	T	A	15: 101,545,156	Q265L	probably damaging	Het
Lama2	A	T	10: 27,054,694		probably null	Het
Laptm4b	G	T	15: 34,238,332	M3I	probably benign	Het
Lmtk2	A	G	5: 144,147,615	Y156C	probably damaging	Het
Lrrc58	G	A	16: 37,881,409	E350K	probably damaging	Het
Macf1	C	T	4: 123,355,102	C7210Y	probably damaging	Het
Madd	A	G	2: 91,152,509	I1363T	possibly damaging	Het
Mcm3	A	G	1: 20,813,110	V295A	probably benign	Het
Mki67	A	G	7: 135,695,592	I2571T	possibly damaging	Het
Mtrr	C	T	13: 68,568,940	A385T	possibly damaging	Het
Myh7b	A	G	2: 155,620,123	Y313C	probably damaging	Het
Myot	A	T	18: 44,354,125	H343L	possibly damaging	Het
Myt1	C	A	2: 181,825,979	Q1069K	probably damaging	Het
Nid1	T	A	13: 13,499,668	D877E	probably damaging	Het
Nle1	A	G	11: 82,905,568	V159A	probably damaging	Het
Nmbr	C	A	10: 14,770,442	Y353*	probably null	Het
Nos1ap	T	A	1: 170,329,166	D241V	probably damaging	Het
Nostrin	A	C	2: 69,166,003	Y209S	probably damaging	Het
Olfr1099	A	T	2: 86,959,281	M59K	probably damaging	Het
Olfr115	T	G	17: 37,610,471	E93D	probably benign	Het
Olfr1168	A	T	2: 88,185,095	S73C	probably benign	Het
Olfr1240	C	T	2: 89,439,583	R232H	probably benign	Het
Olfr283	G	A	15: 98,378,396	T238I	possibly damaging	Het
Olfr378	A	T	11: 73,425,881	M34K	probably damaging	Het
Pcdh7	T	A	5: 58,128,996	V1138E	probably damaging	Het
Pglyrp3	T	G	3: 92,026,567	V173G	probably benign	Het
Plec	T	C	15: 76,183,174	T1331A	probably benign	Het
Plxnb2	T	C	15: 89,156,562	D1787G	probably benign	Het
Pms1	T	A	1: 53,281,988	I29F	probably damaging	Het
Ptprt	G	A	2: 161,811,988	T574I	probably damaging	Het
R3hdm1	A	G	1: 128,190,693	Y561C	probably damaging	Het
Rab17	A	G	1: 90,960,078	F120S	probably benign	Het
Rab7b	T	A	1: 131,698,419	W62R	probably damaging	Het
Ryr2	C	T	13: 11,560,607	G4835E	probably damaging	Het
Ryr3	A	G	2: 112,875,148	V807A	probably benign	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc23a1	C	T	18: 35,626,434	R26Q	unknown	Het
Slc7a4	C	A	16: 17,574,544	R342L	possibly damaging	Het
Slfn9	C	T	11: 82,984,655	C367Y	possibly damaging	Het
Slitrk6	T	G	14: 110,750,794	T494P	probably benign	Het
Tiam1	A	G	16: 89,849,645		probably benign	Het
Tiparp	C	A	3: 65,529,252		probably benign	Het
Tmem39b	T	C	4: 129,678,688	T374A	probably benign	Het
Trim5	G	A	7: 104,276,791	R188*	probably null	Het
Ttn	C	T	2: 76,813,339	G11436R	probably damaging	Het
Ubr4	C	T	4: 139,477,207	T4810M	probably damaging	Het
Vmn2r26	A	T	6: 124,061,237	E590D	probably benign	Het
Wwc1	A	G	11: 35,870,528	F650S	probably benign	Het
Xrcc6	T	A	15: 82,022,977	F167I	probably damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCATAGCGTAAAGTGTTACTCAG -3'
(R):5'- CATCAGGGAAGTAACCTAGGGC -3'

Sequencing Primer
(F):5'- GCGTAAAGTGTTACTCAGTTTAAGAG -3'
(R):5'- AGTAACCTAGGGCCTGCTCTCTAAG -3'

Posted On

2014-10-01