Incidental Mutation 'R5525:Anapc4'
ID 501103
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Name anaphase promoting complex subunit 4
Synonyms D5Ertd249e, 2610306D21Rik, APC4
MMRRC Submission 043083-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 52991477-53024076 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53014151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 440 (M440R)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
AlphaFold Q91W96
Predicted Effect probably damaging
Transcript: ENSMUST00000031072
AA Change: M440R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: M440R

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142035
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199850
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,731 (GRCm39) T1501A probably benign Het
Acin1 G A 14: 54,901,848 (GRCm39) A648V possibly damaging Het
Agap1 A G 1: 89,671,495 (GRCm39) T401A possibly damaging Het
Ankrd26 A G 6: 118,504,692 (GRCm39) M739T probably benign Het
Brip1 T C 11: 86,001,273 (GRCm39) E721G possibly damaging Het
Bzw1 A G 1: 58,442,065 (GRCm39) E221G possibly damaging Het
Cenpm A C 15: 82,123,492 (GRCm39) probably null Het
Exosc1 T A 19: 41,912,457 (GRCm39) K143N probably damaging Het
Fgd5 T A 6: 92,043,228 (GRCm39) L1236Q probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Grm3 C T 5: 9,554,872 (GRCm39) V807I probably damaging Het
Kndc1 A G 7: 139,504,026 (GRCm39) N1110S probably benign Het
Magi1 A T 6: 93,769,354 (GRCm39) V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 (GRCm39) M5298R possibly damaging Het
Nlrp9c T A 7: 26,083,926 (GRCm39) E551V probably damaging Het
Oacyl A C 18: 65,878,427 (GRCm39) I457L probably benign Het
Or12d13 C T 17: 37,647,517 (GRCm39) G202D probably damaging Het
Or5p69 A G 7: 107,967,206 (GRCm39) I170V probably benign Het
Or5t17 A T 2: 86,832,683 (GRCm39) E123D possibly damaging Het
Rab11fip3 T C 17: 26,210,269 (GRCm39) E996G probably damaging Het
Rabep1 T A 11: 70,813,972 (GRCm39) S554T probably damaging Het
Rln1 T C 19: 29,311,920 (GRCm39) E26G probably benign Het
Rpf1 A G 3: 146,223,559 (GRCm39) silent Het
Sdk1 T C 5: 142,171,020 (GRCm39) V1961A possibly damaging Het
Serpinb8 A T 1: 107,535,023 (GRCm39) I365F probably damaging Het
Shank2 A G 7: 143,623,846 (GRCm39) D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,259,538 (GRCm39) probably benign Het
Thsd7a T C 6: 12,332,006 (GRCm39) T1269A possibly damaging Het
Ttll3 A G 6: 113,389,939 (GRCm39) N776D probably benign Het
Unc80 A G 1: 66,645,773 (GRCm39) E1483G possibly damaging Het
Ush2a A G 1: 188,485,803 (GRCm39) D2971G probably benign Het
Zfp322a A G 13: 23,541,685 (GRCm39) V19A probably benign Het
Zfp462 C A 4: 55,050,281 (GRCm39) P2164T possibly damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 53,014,553 (GRCm39) missense probably damaging 0.98
IGL01066:Anapc4 APN 5 53,014,551 (GRCm39) missense probably benign 0.08
IGL01109:Anapc4 APN 5 53,005,970 (GRCm39) missense probably damaging 1.00
IGL01657:Anapc4 APN 5 53,021,968 (GRCm39) nonsense probably null
IGL02692:Anapc4 APN 5 53,021,871 (GRCm39) missense probably damaging 0.98
IGL02734:Anapc4 APN 5 53,018,633 (GRCm39) missense probably benign 0.04
IGL03089:Anapc4 APN 5 53,023,740 (GRCm39) missense probably benign 0.32
IGL03096:Anapc4 APN 5 53,023,271 (GRCm39) missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 53,021,868 (GRCm39) missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52,997,075 (GRCm39) missense probably benign 0.00
R0331:Anapc4 UTSW 5 53,012,984 (GRCm39) splice site probably benign
R0511:Anapc4 UTSW 5 52,999,359 (GRCm39) unclassified probably benign
R0624:Anapc4 UTSW 5 53,002,761 (GRCm39) splice site probably benign
R0919:Anapc4 UTSW 5 53,012,979 (GRCm39) missense probably benign 0.18
R1935:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1942:Anapc4 UTSW 5 53,004,056 (GRCm39) missense probably benign 0.30
R1953:Anapc4 UTSW 5 52,997,030 (GRCm39) missense probably damaging 1.00
R1954:Anapc4 UTSW 5 53,003,967 (GRCm39) intron probably benign
R2341:Anapc4 UTSW 5 52,999,279 (GRCm39) unclassified probably benign
R3696:Anapc4 UTSW 5 53,019,351 (GRCm39) missense probably null 0.01
R4506:Anapc4 UTSW 5 52,993,072 (GRCm39) missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52,999,060 (GRCm39) missense probably benign 0.00
R5234:Anapc4 UTSW 5 53,006,118 (GRCm39) missense probably damaging 1.00
R5256:Anapc4 UTSW 5 53,020,936 (GRCm39) missense probably benign
R5310:Anapc4 UTSW 5 53,016,501 (GRCm39) missense probably benign 0.00
R5401:Anapc4 UTSW 5 53,020,991 (GRCm39) missense probably benign 0.01
R5409:Anapc4 UTSW 5 53,005,941 (GRCm39) missense probably damaging 0.98
R5575:Anapc4 UTSW 5 53,013,213 (GRCm39) missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52,999,076 (GRCm39) nonsense probably null
R5695:Anapc4 UTSW 5 53,019,581 (GRCm39) missense probably benign 0.00
R5955:Anapc4 UTSW 5 53,023,288 (GRCm39) missense probably benign 0.01
R5974:Anapc4 UTSW 5 53,002,742 (GRCm39) missense probably damaging 1.00
R6458:Anapc4 UTSW 5 53,021,895 (GRCm39) missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 53,000,898 (GRCm39) missense probably damaging 0.98
R6633:Anapc4 UTSW 5 53,023,288 (GRCm39) missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 53,006,170 (GRCm39) missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52,993,093 (GRCm39) missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 53,019,577 (GRCm39) missense probably benign
R7327:Anapc4 UTSW 5 53,002,672 (GRCm39) missense probably damaging 0.99
R7442:Anapc4 UTSW 5 53,014,543 (GRCm39) missense probably benign 0.08
R7837:Anapc4 UTSW 5 53,016,550 (GRCm39) critical splice donor site probably null
R8382:Anapc4 UTSW 5 53,016,277 (GRCm39) splice site probably null
R8840:Anapc4 UTSW 5 53,016,473 (GRCm39) missense probably damaging 0.98
R8914:Anapc4 UTSW 5 53,000,843 (GRCm39) nonsense probably null
R8972:Anapc4 UTSW 5 53,007,884 (GRCm39) missense possibly damaging 0.88
R9037:Anapc4 UTSW 5 53,021,843 (GRCm39) missense probably benign 0.16
R9211:Anapc4 UTSW 5 53,007,994 (GRCm39) missense possibly damaging 0.74
R9269:Anapc4 UTSW 5 53,018,620 (GRCm39) missense possibly damaging 0.92
R9294:Anapc4 UTSW 5 53,021,867 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TAGCACCTAAATCACAGCTTGG -3'
(R):5'- GACGAGTTTTCTAAGGAAGTACAGG -3'

Sequencing Primer
(F):5'- GCACCTAAATCACAGCTTGGTTAAAG -3'
(R):5'- CCATTACTGAGGGTTAACAAA -3'
Posted On 2017-12-01