Incidental Mutation 'R6341:Npas2'
ID514359
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39300687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 106 (I106T)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect probably damaging
Transcript: ENSMUST00000056815
AA Change: I106T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: I106T

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
R7833:Npas2 UTSW 1 39326147 missense probably damaging 1.00
R7994:Npas2 UTSW 1 39328337 missense possibly damaging 0.86
R8013:Npas2 UTSW 1 39338065 missense probably benign
R8054:Npas2 UTSW 1 39287571 missense possibly damaging 0.69
R8510:Npas2 UTSW 1 39287472 missense probably damaging 1.00
Z1176:Npas2 UTSW 1 39336010 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGTGTGCAGAGTCAGCCAG -3'
(R):5'- TTGGACACTCTTTAAGCCTCCATG -3'

Sequencing Primer
(F):5'- CAGAGTCAGCCAGTGTGTG -3'
(R):5'- ATGTACCTCCTCCTCACACGTAG -3'
Posted On2018-04-27