Incidental Mutation 'R6341:Cdh26'
ID514372
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Namecadherin-like 26
SynonymsLOC381409
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6341 (G1)
Quality Score184.009
Status Not validated
Chromosome2
Chromosomal Location178430531-178487366 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 178471573 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000042092] [ENSMUST00000042092] [ENSMUST00000108912] [ENSMUST00000108912] [ENSMUST00000108912]
Predicted Effect probably null
Transcript: ENSMUST00000042092
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042092
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042092
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108912
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108912
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108912
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178481624 missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178457447 missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178449962 missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178468174 missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178466828 critical splice donor site probably null
R0610:Cdh26 UTSW 2 178449898 missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178486931 missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178449891 missense probably damaging 1.00
R2483:Cdh26 UTSW 2 178466589 missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178470001 splice site probably benign
R4617:Cdh26 UTSW 2 178460642 intron probably benign
R4914:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4915:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4917:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4918:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R5086:Cdh26 UTSW 2 178441417 nonsense probably null
R5573:Cdh26 UTSW 2 178466689 missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178460126 nonsense probably null
R5941:Cdh26 UTSW 2 178481650 nonsense probably null
R6284:Cdh26 UTSW 2 178449884 missense probably damaging 1.00
R6496:Cdh26 UTSW 2 178449861 missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178486762 missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178470042 missense probably benign 0.02
R7694:Cdh26 UTSW 2 178460103 missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178470035 missense probably damaging 0.98
R8089:Cdh26 UTSW 2 178457577 critical splice donor site probably null
R8103:Cdh26 UTSW 2 178468213 missense probably damaging 1.00
R8412:Cdh26 UTSW 2 178462724 missense probably damaging 0.98
R8413:Cdh26 UTSW 2 178468229 missense probably damaging 0.99
RF002:Cdh26 UTSW 2 178466631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAAGCATCAATGGGTGTC -3'
(R):5'- AGAACCATAAGTGCTGCACC -3'

Sequencing Primer
(F):5'- TCCAGCAGGAAAGACTATCCAGTTC -3'
(R):5'- TAAGTGCTGCACCAACTGG -3'
Posted On2018-04-27