Incidental Mutation 'RF002:Cdh26'
ID602545
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Namecadherin-like 26
SynonymsLOC381409
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF002 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location178430531-178487366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178466631 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 341 (C341R)
Ref Sequence ENSEMBL: ENSMUSP00000048829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]
Predicted Effect probably damaging
Transcript: ENSMUST00000042092
AA Change: C341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155
AA Change: C341R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108912
AA Change: C341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155
AA Change: C341R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178481624 missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178457447 missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178449962 missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178468174 missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178466828 critical splice donor site probably null
R0610:Cdh26 UTSW 2 178449898 missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178486931 missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178449891 missense probably damaging 1.00
R2483:Cdh26 UTSW 2 178466589 missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178470001 splice site probably benign
R4617:Cdh26 UTSW 2 178460642 intron probably benign
R4914:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4915:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4917:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4918:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R5086:Cdh26 UTSW 2 178441417 nonsense probably null
R5573:Cdh26 UTSW 2 178466689 missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178460126 nonsense probably null
R5941:Cdh26 UTSW 2 178481650 nonsense probably null
R6284:Cdh26 UTSW 2 178449884 missense probably damaging 1.00
R6341:Cdh26 UTSW 2 178471573 splice site probably null
R6496:Cdh26 UTSW 2 178449861 missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178486762 missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178470042 missense probably benign 0.02
R7694:Cdh26 UTSW 2 178460103 missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178470035 missense probably damaging 0.98
R8089:Cdh26 UTSW 2 178457577 critical splice donor site probably null
R8103:Cdh26 UTSW 2 178468213 missense probably damaging 1.00
R8412:Cdh26 UTSW 2 178462724 missense probably damaging 0.98
R8413:Cdh26 UTSW 2 178468229 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCATAAGTGATTTGAAAGGG -3'
(R):5'- CCACCTTATCTGGCTGTCAG -3'

Sequencing Primer
(F):5'- CCCATAAGTGATTTGAAAGGGATCTG -3'
(R):5'- GCTGTCAGCCCTGTCTG -3'
Posted On2019-12-04