Incidental Mutation 'R6908:Kirrel3'
ID 538870
Institutional Source Beutler Lab
Gene Symbol Kirrel3
Ensembl Gene ENSMUSG00000032036
Gene Name kirre like nephrin family adhesion molecule 3
Synonyms 2900036G11Rik, Neph2, 1500010O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 34485894-35036716 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35013401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000140219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188658] [ENSMUST00000188933] [ENSMUST00000190549]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045091
AA Change: T295A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: T295A

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115148
AA Change: T328A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: T328A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 54 144 1.35e-9 SMART
IG 155 247 2.56e-1 SMART
Pfam:Ig_3 249 318 7.2e-6 PFAM
IGc2 347 405 1.66e-9 SMART
IG 425 517 1.06e-2 SMART
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 733 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187182
AA Change: T302A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 28 118 1.35e-9 SMART
IG 129 221 2.56e-1 SMART
Pfam:Ig_2 224 305 2.3e-6 PFAM
IGc2 321 379 1.66e-9 SMART
IG 399 491 1.06e-2 SMART
transmembrane domain 510 532 N/A INTRINSIC
low complexity region 612 625 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187625
AA Change: T295A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: T295A

DomainStartEndE-ValueType
IG 21 111 1.35e-9 SMART
IG 122 214 2.56e-1 SMART
Pfam:Ig_2 217 298 2.1e-6 PFAM
IGc2 314 372 1.66e-9 SMART
IG 392 484 1.06e-2 SMART
transmembrane domain 491 513 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
low complexity region 700 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188658
SMART Domains Protein: ENSMUSP00000140086
Gene: ENSMUSG00000032036

DomainStartEndE-ValueType
Pfam:Ig_2 1 31 1.4e-1 PFAM
IG 40 132 4.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188933
AA Change: T295A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: T295A

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 3.7e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 503 525 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 712 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190549
AA Change: T295A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: T295A

DomainStartEndE-ValueType
IG 21 111 5.7e-12 SMART
IG 122 214 1.1e-3 SMART
Pfam:Ig_2 217 298 2.6e-5 PFAM
IGc2 314 372 6.8e-12 SMART
IG 392 484 4.5e-5 SMART
transmembrane domain 491 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Kirrel3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Kirrel3 APN 9 35015253 critical splice acceptor site probably null
IGL01369:Kirrel3 APN 9 35016441 missense probably benign 0.07
IGL01837:Kirrel3 APN 9 35034928 missense probably damaging 1.00
IGL01950:Kirrel3 APN 9 35028329 splice site probably benign
IGL01973:Kirrel3 APN 9 35016468 missense probably damaging 1.00
IGL01994:Kirrel3 APN 9 35020133 missense possibly damaging 0.71
IGL03184:Kirrel3 APN 9 35007756 missense probably damaging 1.00
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0033:Kirrel3 UTSW 9 35000963 missense probably benign 0.06
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0038:Kirrel3 UTSW 9 34911770 splice site probably null
R0390:Kirrel3 UTSW 9 35020163 missense probably damaging 1.00
R0627:Kirrel3 UTSW 9 35035174 missense probably damaging 1.00
R0786:Kirrel3 UTSW 9 35034865 missense probably damaging 1.00
R0920:Kirrel3 UTSW 9 35028352 missense probably damaging 1.00
R0962:Kirrel3 UTSW 9 35000997 missense possibly damaging 0.95
R1716:Kirrel3 UTSW 9 35023547 missense probably damaging 1.00
R2010:Kirrel3 UTSW 9 34939198 missense probably damaging 1.00
R4289:Kirrel3 UTSW 9 35023473 missense probably benign 0.44
R4888:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R4970:Kirrel3 UTSW 9 34944439 missense possibly damaging 0.88
R5121:Kirrel3 UTSW 9 35013305 missense probably damaging 1.00
R5368:Kirrel3 UTSW 9 35007738 missense probably damaging 1.00
R5572:Kirrel3 UTSW 9 35000948 missense probably damaging 1.00
R5707:Kirrel3 UTSW 9 35013276 missense probably damaging 1.00
R6302:Kirrel3 UTSW 9 35007749 missense probably damaging 1.00
R6449:Kirrel3 UTSW 9 34990973 missense probably benign
R6967:Kirrel3 UTSW 9 35034906 missense probably damaging 1.00
R7578:Kirrel3 UTSW 9 34939112 missense probably damaging 1.00
R7861:Kirrel3 UTSW 9 35020123 missense possibly damaging 0.79
R8094:Kirrel3 UTSW 9 35035164 missense probably damaging 1.00
R8383:Kirrel3 UTSW 9 35029883 missense probably null 0.89
R8494:Kirrel3 UTSW 9 34991045 missense probably benign 0.03
R8878:Kirrel3 UTSW 9 34939265 splice site probably benign
R8955:Kirrel3 UTSW 9 34944442 missense probably damaging 1.00
R9140:Kirrel3 UTSW 9 35013300 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGGATCCAGCTTTCAAGG -3'
(R):5'- AGTCCTCAGTAACTGGTCACTG -3'

Sequencing Primer
(F):5'- ATCCAGCTTTCAAGGGGATAC -3'
(R):5'- CAGTAACTGGTCACTGCACTATGAG -3'
Posted On 2018-11-06