Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Kirrel3'

538870

Institutional Source

Beutler Lab

Gene Symbol

Kirrel3

Ensembl Gene

ENSMUSG00000032036

Gene Name

kirre like nephrin family adhesion molecule 3

Synonyms

2900036G11Rik, Neph2, 1500010O20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34485894-35036716 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35013401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 302 (T302A)

Ref Sequence

ENSEMBL: ENSMUSP00000140219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045091] [ENSMUST00000115148] [ENSMUST00000187182] [ENSMUST00000187625] [ENSMUST00000188658] [ENSMUST00000188933] [ENSMUST00000190549]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045091
AA Change: T295A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048863
Gene: ENSMUSG00000032036
AA Change: T295A

Domain	Start	End	E-Value	Type
IG	21	111	1.35e-9	SMART
IG	122	214	2.56e-1	SMART
Pfam:Ig_2	217	298	2.1e-6	PFAM
IGc2	314	372	1.66e-9	SMART
IG	392	484	1.06e-2	SMART
transmembrane domain	491	513	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
low complexity region	700	717	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115148
AA Change: T328A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110801
Gene: ENSMUSG00000032036
AA Change: T328A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	54	144	1.35e-9	SMART
IG	155	247	2.56e-1	SMART
Pfam:Ig_3	249	318	7.2e-6	PFAM
IGc2	347	405	1.66e-9	SMART
IG	425	517	1.06e-2	SMART
transmembrane domain	524	546	N/A	INTRINSIC
low complexity region	601	614	N/A	INTRINSIC
low complexity region	733	750	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187182
AA Change: T302A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140219
Gene: ENSMUSG00000032036
AA Change: T302A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	28	118	1.35e-9	SMART
IG	129	221	2.56e-1	SMART
Pfam:Ig_2	224	305	2.3e-6	PFAM
IGc2	321	379	1.66e-9	SMART
IG	399	491	1.06e-2	SMART
transmembrane domain	510	532	N/A	INTRINSIC
low complexity region	612	625	N/A	INTRINSIC
low complexity region	744	761	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187625
AA Change: T295A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000139951
Gene: ENSMUSG00000032036
AA Change: T295A

Domain	Start	End	E-Value	Type
IG	21	111	1.35e-9	SMART
IG	122	214	2.56e-1	SMART
Pfam:Ig_2	217	298	2.1e-6	PFAM
IGc2	314	372	1.66e-9	SMART
IG	392	484	1.06e-2	SMART
transmembrane domain	491	513	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
low complexity region	700	717	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188658

SMART Domains

Protein: ENSMUSP00000140086
Gene: ENSMUSG00000032036

Domain	Start	End	E-Value	Type
Pfam:Ig_2	1	31	1.4e-1	PFAM
IG	40	132	4.5e-5	SMART
transmembrane domain	151	173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188933
AA Change: T295A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139418
Gene: ENSMUSG00000032036
AA Change: T295A

Domain	Start	End	E-Value	Type
IG	21	111	5.7e-12	SMART
IG	122	214	1.1e-3	SMART
Pfam:Ig_2	217	298	3.7e-5	PFAM
IGc2	314	372	6.8e-12	SMART
IG	392	484	4.5e-5	SMART
transmembrane domain	503	525	N/A	INTRINSIC
low complexity region	580	593	N/A	INTRINSIC
low complexity region	712	729	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190549
AA Change: T295A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000139714
Gene: ENSMUSG00000032036
AA Change: T295A

Domain	Start	End	E-Value	Type
IG	21	111	5.7e-12	SMART
IG	122	214	1.1e-3	SMART
Pfam:Ig_2	217	298	2.6e-5	PFAM
IGc2	314	372	6.8e-12	SMART
IG	392	484	4.5e-5	SMART
transmembrane domain	491	513	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accessory olfactory bulb formation with reduced coalescence of vomeronasal sensory neuron axons in the posterior accessory olfactory bulb, loss of male-male aggression and abnormal male sexual response to a male intruder mouse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Kirrel3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Kirrel3	APN	9	35015253	critical splice acceptor site	probably null
IGL01369:Kirrel3	APN	9	35016441	missense	probably benign	0.07
IGL01837:Kirrel3	APN	9	35034928	missense	probably damaging	1.00
IGL01950:Kirrel3	APN	9	35028329	splice site	probably benign
IGL01973:Kirrel3	APN	9	35016468	missense	probably damaging	1.00
IGL01994:Kirrel3	APN	9	35020133	missense	possibly damaging	0.71
IGL03184:Kirrel3	APN	9	35007756	missense	probably damaging	1.00
R0033:Kirrel3	UTSW	9	35000963	missense	probably benign	0.06
R0033:Kirrel3	UTSW	9	35000963	missense	probably benign	0.06
R0038:Kirrel3	UTSW	9	34911770	splice site	probably null
R0038:Kirrel3	UTSW	9	34911770	splice site	probably null
R0390:Kirrel3	UTSW	9	35020163	missense	probably damaging	1.00
R0627:Kirrel3	UTSW	9	35035174	missense	probably damaging	1.00
R0786:Kirrel3	UTSW	9	35034865	missense	probably damaging	1.00
R0920:Kirrel3	UTSW	9	35028352	missense	probably damaging	1.00
R0962:Kirrel3	UTSW	9	35000997	missense	possibly damaging	0.95
R1716:Kirrel3	UTSW	9	35023547	missense	probably damaging	1.00
R2010:Kirrel3	UTSW	9	34939198	missense	probably damaging	1.00
R4289:Kirrel3	UTSW	9	35023473	missense	probably benign	0.44
R4888:Kirrel3	UTSW	9	35013305	missense	probably damaging	1.00
R4970:Kirrel3	UTSW	9	34944439	missense	possibly damaging	0.88
R5121:Kirrel3	UTSW	9	35013305	missense	probably damaging	1.00
R5368:Kirrel3	UTSW	9	35007738	missense	probably damaging	1.00
R5572:Kirrel3	UTSW	9	35000948	missense	probably damaging	1.00
R5707:Kirrel3	UTSW	9	35013276	missense	probably damaging	1.00
R6302:Kirrel3	UTSW	9	35007749	missense	probably damaging	1.00
R6449:Kirrel3	UTSW	9	34990973	missense	probably benign
R6967:Kirrel3	UTSW	9	35034906	missense	probably damaging	1.00
R7578:Kirrel3	UTSW	9	34939112	missense	probably damaging	1.00
R7861:Kirrel3	UTSW	9	35020123	missense	possibly damaging	0.79
R8094:Kirrel3	UTSW	9	35035164	missense	probably damaging	1.00
R8383:Kirrel3	UTSW	9	35029883	missense	probably null	0.89
R8494:Kirrel3	UTSW	9	34991045	missense	probably benign	0.03
R8878:Kirrel3	UTSW	9	34939265	splice site	probably benign
R8955:Kirrel3	UTSW	9	34944442	missense	probably damaging	1.00
R9140:Kirrel3	UTSW	9	35013300	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTGGATCCAGCTTTCAAGG -3'
(R):5'- AGTCCTCAGTAACTGGTCACTG -3'

Sequencing Primer
(F):5'- ATCCAGCTTTCAAGGGGATAC -3'
(R):5'- CAGTAACTGGTCACTGCACTATGAG -3'

Posted On

2018-11-06