Mutagenetix > Incidental Mutation

Incidental Mutation 'R7394:Malrd1'

573635

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

045476-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7394 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15695199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 619 (D619G)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: D619G

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: D619G

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	G	10: 100,609,176	I208V	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Aldh1l2	T	A	10: 83,502,457	I646F	probably damaging	Het
Alms1	C	T	6: 85,622,223	P1344S	possibly damaging	Het
Ank2	T	A	3: 126,936,653	I711L	possibly damaging	Het
Ankrd6	T	C	4: 32,821,298	N251D	probably damaging	Het
Ap3m1	T	C	14: 21,038,079	T304A	probably benign	Het
Arhgef39	T	C	4: 43,499,532	T26A	possibly damaging	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Carnmt1	G	T	19: 18,670,837		probably benign	Het
Ccr4	C	T	9: 114,491,926	R357H	probably benign	Het
Cd4	T	A	6: 124,873,041	M104L	probably benign	Het
Cd74	A	T	18: 60,803,893		probably benign	Het
Cdcp1	T	C	9: 123,173,813	Y731C	probably damaging	Het
Cdyl2	A	G	8: 116,624,051	S114P	not run	Het
Cenpv	T	C	11: 62,536,288	D148G	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cfap57	T	A	4: 118,593,137	Y596F	probably benign	Het
Clec4a2	C	A	6: 123,139,120	A122E	unknown	Het
Col4a2	A	G	8: 11,446,184	T1602A	probably benign	Het
Cyp2j11	A	T	4: 96,316,440	Y290N	probably benign	Het
Dhx38	A	T	8: 109,556,523	V554E	probably damaging	Het
Ebf2	T	C	14: 67,237,526	V70A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam217a	A	T	13: 34,910,279	I499K	possibly damaging	Het
Fras1	C	A	5: 96,712,450	Y2118*	probably null	Het
Gm3248	A	T	14: 5,945,781		probably null	Het
Gm5460	T	G	14: 34,043,922	D165E	possibly damaging	Het
Grk4	A	T	5: 34,751,618	N490Y	probably benign	Het
Iglc2	T	A	16: 19,195,136	K59*	probably null	Het
Iqsec3	T	A	6: 121,386,610	H895L	possibly damaging	Het
Itgb7	A	G	15: 102,219,254	S410P	probably damaging	Het
Kmt2d	C	A	15: 98,856,384	V1613F	unknown	Het
Lama1	T	C	17: 67,717,261	L118P		Het
Lrrc25	A	T	8: 70,618,180	S204C	possibly damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mup17	G	A	4: 61,594,398	S86F	probably benign	Het
Nbeal2	C	T	9: 110,630,189		probably null	Het
Nfkb1	A	C	3: 135,613,697	V291G	possibly damaging	Het
Nomo1	G	T	7: 46,066,479	V757F	probably benign	Het
Nutm2	T	A	13: 50,470,007	S247T	probably damaging	Het
Olfr1225	C	T	2: 89,170,361	V284I	probably benign	Het
Olfr1291-ps1	G	T	2: 111,499,896	A215S	probably damaging	Het
Olfr521	C	A	7: 99,767,346	H61Q	probably damaging	Het
Olfr826	T	A	10: 130,180,254	I209F	probably damaging	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Pcdhb14	A	G	18: 37,448,908	I356V	probably benign	Het
Pnkp	T	A	7: 44,858,678	S142T	probably damaging	Het
Ppia	T	C	11: 6,419,218	S99P	possibly damaging	Het
Prss47	C	T	13: 65,044,993	V325I	probably benign	Het
Ptk7	T	C	17: 46,591,757	D34G	probably damaging	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Rasa3	G	T	8: 13,595,353	D195E	probably benign	Het
Rnf150	T	A	8: 82,990,471	Y202*	probably null	Het
Sh2d1b2	T	C	1: 170,248,147	V50A	probably damaging	Het
Slc30a4	C	T	2: 122,685,304	V390I	possibly damaging	Het
Slc30a9	G	T	5: 67,352,766		probably null	Het
Slc8a3	T	A	12: 81,214,058		probably null	Het
Smpd3	G	A	8: 106,265,010	R304W	probably damaging	Het
Snta1	A	G	2: 154,376,860	S490P	probably damaging	Het
Srcap	T	G	7: 127,534,828	M887R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sult2a3	T	C	7: 14,111,524	T137A	probably benign	Het
Tspoap1	C	T	11: 87,766,119	Q367*	probably null	Het
Uroc1	C	T	6: 90,345,333	R280C	probably damaging	Het
Ush2a	T	C	1: 188,911,416	I4325T	possibly damaging	Het
Vmn1r32	A	G	6: 66,553,189	I201T	probably benign	Het
Zadh2	C	T	18: 84,088,190	A9V	probably benign	Het
Zfp651	T	A	9: 121,767,345	M626K	probably damaging	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTGGTTCCTAGAAAAGAATGTTTG -3'
(R):5'- TGTGTGTAAAACATCTTTAGGGGC -3'

Sequencing Primer
(F):5'- AAATTGAGAATTCTGCCTTTTCTTTC -3'
(R):5'- GCTTACCTTGAGCTGTACCATGAG -3'

Posted On

2019-09-13