Mutagenetix > Incidental Mutation

Incidental Mutation 'R7062:Rnf17'

548362

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

045158-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R7062 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56402581-56525032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 56465654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 621 (V621L)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]

AlphaFold

Q99MV7

Predicted Effect

probably benign
Transcript: ENSMUST00000095793
AA Change: V621L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: V621L

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223627

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	A	6: 142,599,146	D1370V	probably damaging	Het
Ackr1	A	T	1: 173,332,115	I279N	possibly damaging	Het
Adcy10	A	G	1: 165,538,522	H536R	probably benign	Het
Adgrb3	T	C	1: 25,826,085	T226A	possibly damaging	Het
Apol10b	T	A	15: 77,585,273	M235L	probably benign	Het
Arhgap44	T	C	11: 65,011,932	T570A	probably benign	Het
Astn1	A	G	1: 158,688,511		probably null	Het
Camsap3	A	G	8: 3,607,834		probably benign	Het
Ccdc73	C	T	2: 104,951,878	A193V	probably damaging	Het
Ccl20	G	A	1: 83,117,814	C32Y	probably damaging	Het
Cdk11b	A	G	4: 155,626,811	E16G	probably damaging	Het
Celsr2	T	A	3: 108,402,510	N1591I	possibly damaging	Het
Col5a2	T	C	1: 45,417,625	E306G	probably benign	Het
Cpa1	C	T	6: 30,640,677	A106V	probably benign	Het
Ctdspl	G	A	9: 119,037,470	R199H	probably damaging	Het
Cyfip2	G	A	11: 46,260,832	P547S	probably damaging	Het
Cyp2c37	A	T	19: 39,995,546		probably null	Het
Dnajc16	A	G	4: 141,766,690	F549L	probably damaging	Het
Dnm3	T	A	1: 162,134,491	K50*	probably null	Het
Eci1	C	T	17: 24,426,740		probably benign	Het
Eif2b4	C	T	5: 31,192,831	C49Y	probably benign	Het
Emc3	A	T	6: 113,522,796	I56N	probably damaging	Het
Enthd1	A	G	15: 80,452,544	L563P	probably damaging	Het
Ercc4	T	A	16: 13,132,947	I635K	probably damaging	Het
Espl1	A	C	15: 102,298,896	N265T	probably benign	Het
Fads2	T	C	19: 10,065,598		probably null	Het
Fam186a	G	A	15: 99,933,640		probably benign	Het
Fastkd1	A	T	2: 69,704,322	I368K	possibly damaging	Het
Fat1	G	A	8: 44,950,216	M1I	probably null	Het
Foxj1	T	C	11: 116,331,993	E328G	probably benign	Het
Gfod2	T	C	8: 105,722,876		probably benign	Het
Gm6525	C	T	3: 84,174,891	R40C	probably benign	Het
Gna12	G	A	5: 140,785,485	T144I	probably benign	Het
Ighv9-3	T	C	12: 114,141,092	M11V	probably benign	Het
Kcnj14	T	C	7: 45,817,890	Y344C	probably damaging	Het
Lrrc63	A	T	14: 75,086,297	S496T	probably benign	Het
Ltn1	T	C	16: 87,427,603	T78A	probably damaging	Het
Matr3	T	A	18: 35,579,019		probably null	Het
Mcpt4	A	G	14: 56,060,668	M142T	probably benign	Het
Mroh7	A	G	4: 106,683,980	F1154S	probably damaging	Het
Mrpl1	G	T	5: 96,213,791	L12F	probably benign	Het
Myo3b	G	A	2: 70,217,157	V308I	probably benign	Het
Nfasc	A	G	1: 132,601,969		probably null	Het
Npc1l1	T	A	11: 6,217,807	M995L	probably benign	Het
Nvl	A	G	1: 181,112,334	I617T	probably benign	Het
Oas1h	C	A	5: 120,861,465		probably benign	Het
Oasl2	T	A	5: 114,911,091	Y197*	probably null	Het
Olfr1156	T	C	2: 87,950,224	E3G	probably benign	Het
Olfr262	T	C	19: 12,240,725	N312S	probably benign	Het
Olfr495	C	T	7: 108,395,830	R237*	probably null	Het
Olfr598	T	C	7: 103,329,086	V200A	probably benign	Het
Olfr728	A	G	14: 50,140,450	L63P	probably damaging	Het
Olfr955	A	T	9: 39,470,057	I223N	probably benign	Het
Orc6	T	C	8: 85,302,908	V27A	probably damaging	Het
Parp4	A	T	14: 56,614,759	R799S	possibly damaging	Het
Pcdhga1	C	A	18: 37,825,077	S826R	probably damaging	Het
Phldb1	T	C	9: 44,696,135	R1258G	probably damaging	Het
Ppfia1	T	C	7: 144,552,473	S21G	probably benign	Het
Ppp1r18	C	A	17: 35,868,211	T326K	probably damaging	Het
Psg26	A	G	7: 18,482,596	L106P	probably damaging	Het
Rabgap1l	A	T	1: 160,226,650	D265E	probably benign	Het
Rasgrp4	T	C	7: 29,150,194	L554P	possibly damaging	Het
Sart3	T	C	5: 113,745,602	K783R	possibly damaging	Het
Slc23a2	T	A	2: 132,091,269	I90F	probably damaging	Het
Slc5a2	A	T	7: 128,270,040	M331L	probably damaging	Het
Slc5a7	C	G	17: 54,293,001	G128A	probably damaging	Het
Smcr8	A	T	11: 60,780,354	Q776L	probably damaging	Het
Smpd4	T	A	16: 17,640,971	D519E	probably damaging	Het
Smurf1	A	T	5: 144,893,546		probably null	Het
Spata18	T	A	5: 73,659,293	N125K	probably benign	Het
Spice1	T	A	16: 44,357,896	M94K	probably damaging	Het
Stard4	T	C	18: 33,205,534		probably null	Het
Stx17	A	G	4: 48,140,442	D49G	probably benign	Het
Tbce	T	C	13: 14,019,795	D93G	possibly damaging	Het
Tbx21	T	A	11: 97,098,893	D491V	probably damaging	Het
Tmbim4	G	T	10: 120,208,826		probably benign	Het
Tmem209	C	T	6: 30,502,017	R62H	probably damaging	Het
Tmem237	A	T	1: 59,119,612		probably null	Het
Tmprss9	T	C	10: 80,895,049	I803T	probably benign	Het
Trip4	C	T	9: 65,885,010	A7T	probably benign	Het
Unc13a	T	C	8: 71,663,237	D107G	probably benign	Het
Uso1	C	A	5: 92,192,740	Q672K	possibly damaging	Het
Washc2	T	A	6: 116,219,988	N239K	possibly damaging	Het
Zfp661	A	G	2: 127,577,120	C367R	probably damaging	Het
Znrf3	T	A	11: 5,281,550	E558D	probably damaging	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56421082	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56465750	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56512271	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56463064	nonsense	probably null
IGL01779:Rnf17	APN	14	56462063	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56421166	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56507868	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56500587	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56482135	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56434371	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56427946	missense	possibly damaging	0.74
divest	UTSW	14	56424542	frame shift	probably null
Shed	UTSW	14	56512296	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56514106	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56482193	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56482084	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56438609	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56514175	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56522550	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56475447	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56514165	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56425631	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56467706	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56427979	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56467786	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56493365	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56522399	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56504007	nonsense	probably null
R2015:Rnf17	UTSW	14	56486969	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56431579	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56483380	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56493354	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56505982	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56500547	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56467740	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56434355	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56522391	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56482133	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56486952	splice site	probably null
R5712:Rnf17	UTSW	14	56471399	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56465819	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56505988	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56421169	splice site	probably null
R6626:Rnf17	UTSW	14	56427924	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56438743	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56459975	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56524350	missense	possibly damaging	0.93
R7103:Rnf17	UTSW	14	56471306	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56512332	splice site	probably null
R7527:Rnf17	UTSW	14	56516438	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56438878	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56462072	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56477687	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56487022	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56421136	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56467722	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56424542	frame shift	probably null
R8321:Rnf17	UTSW	14	56424542	frame shift	probably null
R8379:Rnf17	UTSW	14	56424542	frame shift	probably null
R8380:Rnf17	UTSW	14	56424542	frame shift	probably null
R8381:Rnf17	UTSW	14	56424542	frame shift	probably null
R8382:Rnf17	UTSW	14	56424542	frame shift	probably null
R8383:Rnf17	UTSW	14	56424542	frame shift	probably null
R8799:Rnf17	UTSW	14	56500429	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56485201	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56524328	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56482097	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56460038	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56482122	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56485179	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56467706	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- CTGCCTCAGATGATTCCTAAATGC -3'
(R):5'- ACTCATAATATCTTCAGCCCCTAG -3'

Sequencing Primer
(F):5'- CCTAAATGCATATGGTTGGTTCAG -3'
(R):5'- CTTCAGCCCCTAGAACTTAAATATTG -3'

Posted On

2019-05-13