Incidental Mutation 'R7174:Vmn2r53'
ID 558488
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7174 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12581701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 730 (H730Q)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: H730Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: H730Q

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCTATTGTGCTGTACCTG -3'
(R):5'- GACAGGGATATGATCTCAGAGCC -3'

Sequencing Primer
(F):5'- CTGTACCTGGTGGCCTTGC -3'
(R):5'- TGTCATCCAATGCCATGAGG -3'
Posted On 2019-06-26