Incidental Mutation 'R7255:Ipo9'
ID564175
Institutional Source Beutler Lab
Gene Symbol Ipo9
Ensembl Gene ENSMUSG00000041879
Gene Nameimportin 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7255 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135382312-135430499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135385988 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 984 (E984G)
Ref Sequence ENSEMBL: ENSMUSP00000036093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189]
Predicted Effect probably benign
Transcript: ENSMUST00000041023
AA Change: E984G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: E984G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
low complexity region 911 922 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161032
SMART Domains Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161189
SMART Domains Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161934
SMART Domains Protein: ENSMUSP00000124210
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
Meta Mutation Damage Score 0.3138 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Ipo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Ipo9 APN 1 135400059 missense probably damaging 1.00
IGL01611:Ipo9 APN 1 135386693 missense possibly damaging 0.76
IGL01941:Ipo9 APN 1 135408073 missense possibly damaging 0.95
IGL01944:Ipo9 APN 1 135405886 missense probably damaging 0.98
IGL01959:Ipo9 APN 1 135420355 critical splice acceptor site probably null
IGL02649:Ipo9 APN 1 135385934 missense possibly damaging 0.92
IGL02697:Ipo9 APN 1 135390576 missense probably benign 0.00
IGL03286:Ipo9 APN 1 135407078 intron probably benign
FR4304:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4304:Ipo9 UTSW 1 135386279 nonsense probably null
FR4340:Ipo9 UTSW 1 135386269 small insertion probably benign
FR4340:Ipo9 UTSW 1 135386271 small insertion probably benign
FR4548:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386266 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386281 small insertion probably benign
FR4976:Ipo9 UTSW 1 135386281 small insertion probably benign
R0111:Ipo9 UTSW 1 135405924 missense probably damaging 0.97
R0238:Ipo9 UTSW 1 135404336 splice site probably benign
R0239:Ipo9 UTSW 1 135404336 splice site probably benign
R0279:Ipo9 UTSW 1 135420363 intron probably benign
R0704:Ipo9 UTSW 1 135386268 small deletion probably benign
R1070:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1282:Ipo9 UTSW 1 135402292 missense possibly damaging 0.48
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1728:Ipo9 UTSW 1 135386268 small insertion probably benign
R1728:Ipo9 UTSW 1 135386271 small insertion probably benign
R1728:Ipo9 UTSW 1 135402250 missense probably benign
R1729:Ipo9 UTSW 1 135386268 small insertion probably benign
R1729:Ipo9 UTSW 1 135402250 missense probably benign
R1730:Ipo9 UTSW 1 135386268 small insertion probably benign
R1730:Ipo9 UTSW 1 135402250 missense probably benign
R1739:Ipo9 UTSW 1 135386268 small insertion probably benign
R1739:Ipo9 UTSW 1 135402250 missense probably benign
R1762:Ipo9 UTSW 1 135386268 small insertion probably benign
R1762:Ipo9 UTSW 1 135402250 missense probably benign
R1783:Ipo9 UTSW 1 135386268 small insertion probably benign
R1783:Ipo9 UTSW 1 135402250 missense probably benign
R1784:Ipo9 UTSW 1 135386268 small insertion probably benign
R1784:Ipo9 UTSW 1 135402250 missense probably benign
R1785:Ipo9 UTSW 1 135386268 small insertion probably benign
R1785:Ipo9 UTSW 1 135386281 small insertion probably benign
R1785:Ipo9 UTSW 1 135402250 missense probably benign
R1899:Ipo9 UTSW 1 135400146 missense probably damaging 0.99
R2049:Ipo9 UTSW 1 135386268 small insertion probably benign
R2049:Ipo9 UTSW 1 135402250 missense probably benign
R2130:Ipo9 UTSW 1 135386268 small insertion probably benign
R2130:Ipo9 UTSW 1 135402250 missense probably benign
R2131:Ipo9 UTSW 1 135386268 small insertion probably benign
R2131:Ipo9 UTSW 1 135402250 missense probably benign
R2133:Ipo9 UTSW 1 135386268 small insertion probably benign
R2133:Ipo9 UTSW 1 135386275 small insertion probably benign
R2133:Ipo9 UTSW 1 135402250 missense probably benign
R2136:Ipo9 UTSW 1 135394285 missense probably damaging 0.98
R2141:Ipo9 UTSW 1 135386268 small insertion probably benign
R2141:Ipo9 UTSW 1 135402250 missense probably benign
R2142:Ipo9 UTSW 1 135386268 small insertion probably benign
R2142:Ipo9 UTSW 1 135386275 small insertion probably benign
R2142:Ipo9 UTSW 1 135386282 small insertion probably benign
R2142:Ipo9 UTSW 1 135402250 missense probably benign
R2356:Ipo9 UTSW 1 135406817 missense probably benign 0.00
R2923:Ipo9 UTSW 1 135400129 missense probably benign 0.25
R3161:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R4086:Ipo9 UTSW 1 135388690 unclassified probably benign
R4679:Ipo9 UTSW 1 135394169 missense probably benign
R4816:Ipo9 UTSW 1 135406550 missense probably benign 0.21
R4956:Ipo9 UTSW 1 135404222 critical splice donor site probably null
R5052:Ipo9 UTSW 1 135388611 unclassified probably null
R5055:Ipo9 UTSW 1 135402359 nonsense probably null
R5230:Ipo9 UTSW 1 135420070 missense probably damaging 1.00
R5240:Ipo9 UTSW 1 135389606 unclassified probably benign
R5257:Ipo9 UTSW 1 135385435 missense probably damaging 1.00
R5340:Ipo9 UTSW 1 135385432 missense probably benign 0.00
R5560:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5602:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5604:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5654:Ipo9 UTSW 1 135385472 nonsense probably null
R6018:Ipo9 UTSW 1 135390536 critical splice donor site probably null
R6128:Ipo9 UTSW 1 135390573 missense possibly damaging 0.90
R6841:Ipo9 UTSW 1 135386308 missense probably benign
R7230:Ipo9 UTSW 1 135406758 critical splice donor site probably benign
R7383:Ipo9 UTSW 1 135388673 missense probably damaging 1.00
Y5405:Ipo9 UTSW 1 135386269 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386275 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386284 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AATGCCTGCTTCCTAAGGGG -3'
(R):5'- CACACTGGTGCCCAAAATGG -3'

Sequencing Primer
(F):5'- CCGTGGAACTGATATACATACGTGAC -3'
(R):5'- CTGGTGCCCAAAATGGAGTACC -3'
Posted On2019-06-26