Incidental Mutation 'R7255:Dsc1'
ID 564235
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Name desmocollin 1
Synonyms Dsc1a, Dsc1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20084184-20114871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20097273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 325 (R325Q)
Ref Sequence ENSEMBL: ENSMUSP00000042303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
AlphaFold P55849
Predicted Effect probably benign
Transcript: ENSMUST00000038710
AA Change: R325Q

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: R325Q

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224432
AA Change: R325Q

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense probably benign
R8167:Dsc1 UTSW 18 20097201 missense probably damaging 1.00
R8444:Dsc1 UTSW 18 20089579 missense probably benign 0.00
R8701:Dsc1 UTSW 18 20107682 nonsense probably null
R8928:Dsc1 UTSW 18 20110168 missense probably benign 0.01
R9133:Dsc1 UTSW 18 20101847 missense probably benign 0.00
R9144:Dsc1 UTSW 18 20085582 missense possibly damaging 0.95
R9189:Dsc1 UTSW 18 20099157 missense possibly damaging 0.52
R9330:Dsc1 UTSW 18 20110157 missense possibly damaging 0.67
R9372:Dsc1 UTSW 18 20088432 missense probably damaging 1.00
Z1176:Dsc1 UTSW 18 20114538 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAGGAAGCTGGCATATTCTAGATG -3'
(R):5'- GGGCATGCAGTTGTGTTAACAC -3'

Sequencing Primer
(F):5'- TGGCGAGTTGTCATTCTC -3'
(R):5'- TCATAACTGTCAGTGAGTGGAAATAG -3'
Posted On 2019-06-26